The Lottery Dissecting Sociological Horrors Essay

The Lottery: Dissecting Sociological Horrors When you hear the word â€Å"lottery†, what do you think? In Shirley Jackson’s The Lottery, readers are presented with an ironic, dramatic, bleak tale about a small village gathering for not exactly what one would call a lottery. Born in San Francisco, California in 1916, Jackson spent much of her early life writing poetry and journal entries. After enrolling in the University of Rochester, she eventually withdrew to pursue her dreams of becoming a writer. Jackson later decided to attend Syracuse University, where she published a variety of fiction and nonfiction campus magazines. After graduating and getting married in 1940, Jackson then moved to New York City, where she printed her first national short story. In 1948, The Lottery, one of her most famous short stories of all time was published. The story had its first of several television adaptations in 1952. While most of Jackson’s work is credited to her horrendous and comedic tales, she seems to master the m orality theme as well (Hrebik). Many authors claim to have been influenced by her works: Stephen King, Neil Gaiman, Nigel Kneale, and Richard Matheson. Although Jackson’s stories often confuse many critics, that is what makes her tales so popular today. Years later, she is still regarded as one of the most remarkable and influential authors of the twentieth century. The idiosyncratic and engaging techniques allow readers develop their own idea of what they are reading. In

Do Minimum Wage Laws Increase Unemployment Essay

The current minimum wage, as set by federal law, is less than $15 per hour. Is this enough for any person to provide for themselves and their family? Laborers earning the minimum wage dont seem to think so and are wanting an increase in the required minimum wage so they will be paid more by their employers. The Bureau of Labor Statistics reported in 2015 that 3.6 million workers earned below or at the minimum wage (Minimum Wage Workers). At first it sounds wonderful for minimum wage workers to earn extra money and be able to make a better living, but what impact does an increase to the federal minimum wage have on the economy? Citizens of the US in 1912 were concerned about employers turning their jobs into sweatshops by†¦show more content†¦The value of money decreases when it’s more accessible, which means it will take more cash to buy the same amount of goods and services as before. This is most radically understood when studying the effects of the recent bou t of hyperinflation as experienced by Zimbabwe. The government of Zimbabwe ran large budget deficits and attempted to close the gap by printing a lot of their currency, the Zimbabwean Dollar. In January 2008, after years of experiencing hyperinflation due to this injection of money in their economy, the central bank of Zimbabwe began issuing notes worth millions of Zim Dollars. This rendered the lesser denominations of Zimbabwe’s currency worthless, and signs outside public restrooms began restricting people from using Zim Dollars instead of toilet paper (Mankiw). Unemployment is another concern when the minimum wage increases. Employers are mandated by federal law to pay their current and future employees the new minimum wage despite potentially no increases in their workers productivity. When a businesss base line is increased in this way they lose out on profits they could have been making. By profiting less than before, an employer may not be able to provide benefit s, have resources to train their employees appropriately, or employ more workers in the future. Despite these concerns, it is a fact that millions of workers earning the minimum wage will be helped out of poverty by thisShow MoreRelatedMinimum Wage And Its Effect On The Economy1015 Words   |  5 Pagesthe unemployment rate. The increasing of unemployment rate is caused by some reasons, and one of the problem that causes the high unemployment rate is the issue of minimum wage. Depending on the states in U.S., the price of minimum wage is different, but the low minimum wage may cause the economic condition worse. Minimum wage is the lowest wage that an employer is allowed to pay. This wage is regulated by the law, so all workers must follow this rule. According to the book, â€Å"Minimum Wages†, theRead MoreLink between Higher Minimum Wage and Higher Unemployment1179 Words   |  5 PagesIn theory when an increase in minimum wage increases the cost of low-wage workers firms should want to hire less workers, however in reality this basic theory might be wrong according to Plumer B. (2013) While some studies found a link between higher minimum wage and higher unemployment level many others such as a recent paper from U.C. Berkeley that exploited differences across state borders did not find a link between higher minimum wage and higher unemployment. A study by John Schmitt of theRead MoreThe Regulation Of Minimum Wage1055 Words   |  5 PagesRegulation of Minimum Wage In today’s society, people face to many serious issues which affect the society both in a positive and negative ways such as increasing the employment rate and increasing the unemployment rate. The increasing of the unemployment rate is caused by some reasons, and one of the problems that causes the high unemployment rate is the issue of the minimum wage. Depending on the states in the U.S., the price of minimum wage is different, but the low minimum wage may cause theRead MoreCongress As Part Of The Fair Labor Standards Act1084 Words   |  5 PagesStandards Act (FLSA) instituted minimum wage back in 1938. The first minimum wage was at $0.25 per hour and the last minimum wage increase occurred in 2007. Over the past 65 years the minimum wage has varied considerably in inflation-adjusted buying power. It has averaged $6.60 an hour in purchasing power in 2013 dollars, but it has ranged from a low of $3.09 an hour in late 1948 to a high of $8.67 an hour in 1968. Today’s minimum wage buys somewhat more than the minimum wage has historically, althoughRead MoreThe Effects of Raising the Minimum Wage on US Economy1507 Words   |  6 Pagessupport their family. Due to the fact that the prices of goods increase year and after year, the minimum wage has been increasing from less than a dollar to $7.25 now. The question that comes to everybody is that should we increase the minimum wage by too far. Does the minimum wage increase reduce the unemployment since now the current wage is high enough? Some people might think that we should increase the minimum wage in order to increase the labor supply. However, if we think deeply than this, thereRead MoreEssay on Pros and Cons of Minimum Wage701 Words   |  3 PagesCons of Minimum Wage The argument for minimum wage has remained remake consistent over the years. Some people are against minimum wage and the other think minimum wage can help you in a certain way. In the midst of the Great Depression, the Unites States federal government passed the Fair Labor Standards Act. The law has been amended almost every year to expand coverage of the wage floor and to increase the wage itself. Many of the fifty states have enacted their own minimum wage laws, some ofRead MoreImpacts Of A Minimum Wage Hike900 Words   |  4 Pagesto a Minimum Wage Hike in America There has been much controversy over the years on the impacts resulting from an imposed minimum wage and how it relates to the economy. It wasn’t until President Franklin D. Roosevelt signed a Bill enacting the Fair Labor Standards Act of 1938 that American’s gained the right to a minimum threshold by which their labor could be sold. Against much opposition President Roosevelt was for a law that banned oppressive child labor and set the minimum hourly wage at .25Read MoreRaising The Minimum Wage?1575 Words   |  7 PagesThe issue of raising the minimum wage from $7.25 to $15 an hour is a heavily debated topic. Both sources against or in favor of the minimum wage refer to a â€Å"growing gap† between low-income workers and high-income earners. Sources against the minimum wage believe raising it will increase this gap, whereas those in favor of the minimum wage believe it will decrease this gap. The arguments in favor of the minimum wage rely mostly on ethical beliefs, such as â€Å"pay should reflect hard work,† to advanceRead MoreDoes the Minimum Wage Increase the Standard of Living for Low-Income People?1391 Words   |  6 PagesThe United States has maintained a minimum wage which was enacted since 1938. At the present time there is much political debate in regarding to increase the minimum wage to levels at the federal level, state, and local levels of government across this country. There are various theories regarding the minimum wage. Some believe it would circulate money into the economy faster which would negate and negative effects on employment, or even improve unemployment rates. Others point to the economic theoryRead MoreMinimum Wage And The Wage Essay1728 Words   |  7 Pages Royer Political Science 120 7 November 2016 Increase Minimum Wage Introduction The United States’ minimum wage has been a concerning issue amongst the low wage earners because of the amount they earn is not enough for them to live on their own. Therefore causing the citizens who earn minimum wage to have an impossible time finding a place to stay and expenses for daily survival. Increasing the minimum wage will solve the issues that the minimum wage earners make, thus increasing the chances of

I Knew This Was My Moment Free Essays

I could remember when I was young, one day, my mother suddenly dragged me out to a concert that I wasn’t all that enthusiastic about. I was planning on persuading my mother otherwise, but the moment I stepped in and the concert started, I immediately fell in love. I was enchanted by the stage effects, the dancers, and the pure vocal talent of the artist. We will write a custom essay sample on I Knew This Was My Moment or any similar topic only for you Order Now It was then that everything had started, and my world had changed. At that moment, I knew what I wanted in life. Immediately after the concert, I told my mother that I wanted to sign up for vocal and dancing lessons. Needless to say, she was astonished at my sudden change of attitude, but she seemed to understand. Over the years, I trained, and over the years, my passion grew. My life revolved around the dance and vocal lessons I took. But of course, my studies weren’t neglected; I needed a back-up plan if my plans to become a star fell through, though I would definitely prefer if it didn’t. Many people said that aspiring to become a singer was not realistic, that it was just that, a dream. But I never wavered, I never felt discouraged, and most importantly, I never lost hope. When I was sixteen, I took part in a local singing competition, and was unexpectedly scouted by a representative of a small talent agency. He gave me his name card, introduced himself, and told me to call if I was interested. That day, I ran all the way home, and told my parents. Although they didn’t seem to agree with me, being only sixteen and all, they eventually caved in with my constant begging. With their consent, I immediately dialed the number on the card, I wasn’t about this chance pass me by. After that phone call, my life took another turn. I was thrown into a busy life with almost no free time for myself. I’d spend the whole morning in school, and then my afternoons, and sometimes evenings, as a trainee at the agency. Although every day was tiring, I enjoyed those days. That life lasted for about four months. After four months as a trainee, they decided that I had enough training, that I was good enough and could finally have my debut, with all the lessons I had before entering the agency. The moment I received the news, I was ecstatic for days, almost nothing could bring me down. The two months after that were spent writing and composing songs. It was decided that they would strip away all other stage effects and focus on my voice, which was my forte. And now, sitting in the preparation room while make-up artists do their final touch up on my face, I recall the past and how my dream had started. Instead of letting my dream remain a dream, I was about to make it come true. More than nervous, I feel excited. Instead of standing below the stage, watching performers enchant the audience, it was finally my turn to stand upon that ground and demand the attention of the whole stadium. Standing backstage and watching the audience of hundreds, maybe a thousand, I could feel the nerves getting to me, and then the excitement overriding the nerves. The curtains closed upon the end of the previous act, a signal for me to go on stage. This was it, I thought, as the MC introduced me, the curtains opened, and the lights blinded me. Blinking a few times as my eyes adapted to the light, I could see clearly right in front of me, the thousands of people in the audience. At that moment, I knew. I knew that this was my moment, and it was going to be all or nothing. This was the moment I have been waiting for all my life, the moment I have gone through all the blood, sweat and tears for. This was the moment that would change my life, for good; the moment that would decide if my career as a celebrity would turn for the better or for the worse. After all, in the entertainment industry, it’s the first impression that counts. Standing on the extravagant stage, half blinded by the lights, in awe of the number of people in the audience, and excitement rushing through every pore of my being, I sung my heart out, expressing my ineffable feelings for it, for music. Giving it my all, all I could do now was hope that my all was enough. How to cite I Knew This Was My Moment, Papers

Intercultural Relations Social Developments

Question: Discuss about theIntercultural Relations for Social Developments. Answer: Introduction For anyone seeking to understand the Indian diversity a prayer from old texts of India can make it simpler as it states, May from all direction come good thoughts to us. People in India embrace diversity, variety, unconventionality and heterodoxy. Diversity in India is an asset and is being cherished. The countries historical, political, economic and have been guided by many distinct parts of such a culture. It is important to remember to take into consideration the various ethnic and linguistic groups, religious groups, philosophical and social and economic levels before. In any culture let it be Rajasthan, Maharashtra, Gujarat or Punjab there are always peripheral cultural universal traits like morals, telling truth, etc, and internal cultural traits which are core of the culture. There is an increase in economic activities inter and intra nation. To establish a successful business it is thus important to consider and concentrate on various factors including language, culture, and backgrounds. The most significant factor is culture. The working of cultural differences within nations and across nations is important to be understood for it can affect the business activities (Taylor, 2012). Language, political philosophy, economical philosophy, education and social structure are the main determinants of any culture. For any companys business success cultural sensitivity plays a crucial role; therefore it is crucial for businesses to understand the various cultural determinants (Barrett, 2013) Exchange of messages verbal or non-verbal is communication, participated by all individuals. Between groups or individuals communication are constantly exchanged and the communication can either be in written words or spoken words or even silence (Penas Saenz, 2006). Communication can be stated as a process which cannot be avoided by any individual because all behaviour has a message. Change in human behaviour results due to culture. In a non-verbal communication the most important factors are eye contact, gestures, touch and spatial behaviour. Again the values of individuals vary from culture to culture. The values impact an individuals behaviour and performance. In this study to understand the various cultural relations an attempt has been made to understand various determinants between Rajasthans culture with Gujarati, Marathi and Punjabi culture. As stated by John (2008), business is the best arena to watch culture in action. For the better understanding of the cultural relations low and high context model has been used with modifications to suit the intercultural relation within Indian union. Though it is thought that international business relations are a matter of concern but inter nation relations are not easy and especially in a country like India, where there are various cultures operating. Intercultural Relations Hindus comprise the majority of the population here, and the culture and traditions are known for being colourful. In the past few years Rajasthan has been a preferred destination for IT parks. It has the northern Indias largest IT Park. Tourists from all over India and the world visit Rajasthan. It is said to be the place of the Rajas. The state of the Indian Union has the largest desert of India Thar. The culture here reflects the ancient Indian lifestyle. Being a major tourist destination the language is not much of a barrier but the accent and the speed does. People of Rajasthan like every other state in India have a peculiar accent and tone which varies from cities to villages. Amartya Sen stated that Prolixity is not alien to Indians because Though adjoining states Gujarat, Maharashtra and Rajasthan has barriers of language. A typical Marathi speaking individual would find it very difficult to communicate with a typical Marwari speaking individual. A Punjabi individual would have the same problem. For example, a brother is called Bhaou in Marathi, while a Gujarati would say Mota Bhai, A Punjabi would say Paji and a Rajasthan Individual would say Bhayo. The cuisines of the four cultures are very different. The attire of the women has much dissimilarity. Also the dance forms and music are very dissimilar. While Lavani is a dance form in Maharashtra, Garbha is a dance form of Guj arat, in Rajasthan Ghumar is the dance form while Bhangra is the typical dance form of Punjab. The cultures of Rajasthan, Gujarat, Maharashtra and Punjab shares similarity when it comes to attire the dhoti and the turbans worn by people from all the four cultures, women tend to wear Salwar suits in Punjab, Lehenga-choli in Rajasthan, Saree in Gujarat and Lugada in Maharashtra, thus the attire of women has more diversity than of men. Again a similarity is seen when it comes to the religion the four cultures are dominated by Hindus and are very religious in nature. Also the four cultures are viewed as festive. Ones view of reality is always shaped by ones culture. An individual from Maharashtra is considered introvert, while a person from Punjab is considered as an extrovert, the Rajasthans individual is again an introvert, and a Gujarati is also considered as an extrovert. It is culture that makes people believe that they share similar reality. In case of Rajasthan, Maharashtra, Gujarat and Punjabs culture may share a uniformity as being part of one nation but the basic lifesty le, language, perception about realities, goodness, dressing style, eating habits varies from place to place; not just between states but within in states itself (Cinquina, 2016). The joy and colours of the four cultures are evident in their way of life and life celebration. According to Alfred sphutz, a persons stock of knowledge determines his perception towards other cultures. Life-world= for example a man enters a bus and he knows that there is going to be a bus driver and a conductor in the bus and the conductor is going to ask money for the ticket, now how does the person entering the bus would have knowledge about something that has not happened yet? This is because people are stocked with knowledge collected either first-hand or second hand or transmitted by one generation to another with the use of language. This culture as repeated by people becomes a system and there are several parts to this system like personality system, integration system, latency system or adaptation, etc (Kazuya Kim, 2004). As Levis strauss stated that the most two important parts in culture is what could be done and what could not be done, he further states that the mind div ide things in two parts; meaning that in every culture few things are never going to change and few things are always going to change (Strauss, 2005). India being a high context country the vocabulary used is very vast here, be it a Marwari language, or Gujarati, or Marathi or a Punjabi language. People do not like to respond in short sentences. The basic barriers and dissimilarity are: The sentence structure is different Lack of inter-subjectivity Stock of Knowledge Socialization The pattern of speech are different The accent and intonations are different The vocabulary is different It is difficult for all the above mentioned cultures to process English at some level (Heyward, 2002). These stated problems among the four cultures due to languages are the biggest barrier to communication. These intercultural barriers could make it very difficult for a Marathi culture individual to be able to develop a relationship with a Rajasthans individual. There are also non-verbal communication issues: The use of language with meanings implied Symbols Stereotye Behaviour, i.e. Instead of asking people make assumptions People from different parts of India face communicating with each other difficult due to the non-verbal communication. If one crosses the hurdle of verbal communication non-verbal communication can be tricky. Non-verbal communication comprises Kinesics, haptics and proxemics. India communication heavily relies on indirect and non-verbal communication techniques. A variety of contextual cues are also involved in an individuals discourse of communication (Yampolsky Amiot, 2016). This is to say that the use of word No is not very common. People generally reply without a direct no to a question and take escapes by using open-ended answers like, I will let you know. To understand the non-verbal communication of a culture observation of the subject culture is required (Kazuya Kim, The effect of self-construals on conversational indirectness, 2004) The result of globalisation and increased awareness a universal culture or global culture has taken shape. This culture is more or less similar to the western world. According to McKim Merriot, universalization and parochialization takes place, in universalization all the minor cultures are accumulated into the universal culture and in perochialization the smaller culture takes over the major culture when folklore assume as greater importance in a major culture it takes over the major culture eventually (Marriot, 1993). When cultural uniqueness is lost globalization of culture takes place. According to Bourdeau Habitus is a kind of live world and individuals aim to control this live world (Bourdieu, 1990). Thus if a Maharashtra person want to transact business in Rajasthan he would like to know what are the similarities that would help him to assimilate and gain control. Leading to inter-subjectivity where a Maharashtra persons stock of knowledge is connected with the stock of knowledge of the Rajasthans person. This would develop a feeling of similarity and create motivation. Thus for transacting a successful business the three cultures of Gujarat, Maharashtra and Punjab would have to develop inter-subjectivity. Also in every culture there are standards and hero, like in Maharashtra Shivaji is a cultural hero, and in Rajasthan the warriors of Rajasthan are the heroes and there are set standards to them, thus enhancing inter-subjectivity and motivating the indigenous culture. Also to resolve conflict in business transaction it is advisable to accommodate, assimilate, acculturate and diffusion of cultures (Berry, 2005). To develop effective skills and an excellent nurse/patient relationship it is important that a meaningful communication takes place (Kourkouta Papathanasiou, 2014). For the development of meaningful communication and improvement in ones skills it is crucial that the nurses engage in reflection analysis (Kourkouta Papathanasiou, 2014) The best way to motivate and commence business in a cross-cultural environment is to understand ones partner well. Doing so enhances the chances of cultural adjustments. For motivating people from any cultural background it is crucial that the business transaction intended confirms with the norms of the said culture (Hooker, 2008). Though it is many times believed that business is self-contained process in reality for any business to get anything done; the business is dependent on cultural mechanisms which are pre-determined. With the evident of new world economic order a multi-polar equilibrium has replaced world hegemony. References Barrett, M. (2013). Interculturalism and multiculturalism: similarities and differences. Council of Europe. Berry, J. W. (2005). Acculturation: Living successfully in two cultures. International Journal of Intercultural Relations, 697-712. Bourdieu, P. (1990). The Logic of Practice. Stanford University Press. Cinquina, P. (2016). Performing Intercultural Dialogue on the Stage. Journal of Intercultural Communication. Heyward, M. (2002). From International to Intercultural Redefining the International School for a Globalized World. Journal of Research in Intenational Education. Hooker, J. N. (2008). Cultural Differences in Business Communication. m: Carnegie Mellon University. Kazuya, H., Kim, M. S. (2004). Cross-Cultural Communication and Intercultural Competence. International Journal of Intercultural Relations, 1-8. Kazuya, H., Kim, M. S. (2004). The effect of self-construals on conversational indirectness. International Journal of Intercultural Relations, 1-18. Kourkouta, L., Papathanasiou, I. V. (2014). Communication in Nursing Practice. MasteriaSocioMedica, 26(1), 65-67. Marriot, M. (1993). India's Village. In G. P. Vijay.S.Upadhyay, History of Anthropological Thought (pp. 440-543). Concept Publishing. Penas, B., Saenz, M. C. (2006). Interculturalism: Between Identity and Diversity. Peter Lang. Strauss, L. C. (2005). Myth Meaning. Routledge Kegan. Taylor, C. (2012). Interculturalism or multiculturalism? SAGE journals. Yampolsky, M. A., Amiot, C. E. (2016). Discrimination and multicultural identity configurations: The mediating role of stress. International Journal of Intercultural Relations .

Justin Lieber Essays - Fictional Cyborgs, Death, Brain,

Justin Lieber I read how to build a person by Justin Lieber. Justin Lieber is a professor at the University of Houston, whom also writes science fiction. This selection, which was taken from his novel Beyond Rejection, is fictional and is based in the future. The story is set in the year 2112 in a Houston hospital. In this hospital they are brains on one person into the body of another. The story starts with the hospital giving a class on how they are attempting to transplant a mind into a human body. The test subjects name was Sally Cudmus, and she has been frozen in ice for two years. In this story they discuss the difficulties of implanting a brain into a body. They talk of the problems that would occur if a mind was implanted into a body that was not it's own. They say this is possible due to the fact that the brain can adapt to major changes around it with in days. The example they give to show this is possible is one with reverse goggles. If a person puts on goggles that would make everything appear upside down the person would be disoriented. After a few day the subjects brain would adapt to these changes making what the goggles made upside down rights side up. If the goggles were then taken off everything again would seem upside down, until the brain once again adapted to this change. In this story it is said that a mind is like a tape, and the only thing this tape needs is a body similar to its original to function. I do not agree with this because a brain is not like any other organ that can be transplanted. A person's brain is dynamic in that it functions with a particular person, and is one of a kind. No matter how similar the body types may be, a humans brain and thoughts can not be transferred to another body. In my opinion a person's brain would not adapted to such a drastic change as a body switch. In the end the subject wakes up remembering who he once was. After touching his new body he realizes he is no longer in his original figure. The subject does not like this because his new body was much different then his own. He no longer had a penis and his muscular for he once had was gone. Also a tale like extension had grown from his spinal cord to his feet. The subject realizes that he will no longer be who he once was, and is understandably discontent.

Unnoticed Children Essay

Unnoticed Children Essay Unnoticed Children Essay June19, 2013 Amili Au Mark Keppel, 10 Unnoticed children Prompt: In your speculative writing, describe and analyze Salvador’s situation. Then examine what information, causes. Effects and possibilities will result if Salvador’s world doesn't change. Explain from the point of view of your role in Salvador’s world. Salvador is a child from a poor family with three younger brothers that he has to take care of. To my analysis, the mother is a single parent that has to take care of a baby and does not have the time to take care of the kids, so the oldest child took care of everyone. Salvador has to wake up early in the morning to wake his brothers up, tie their shoes, comb their hair and prepare breakfast for him and his three younger brothers. When it is time to leave to school, he runs with his brothers to school. In school, Salvador is a very lonely child with no friends; even the teachers don't remember his name. I think he is just very shy and even he had a friend, he would have the time to go out with his friends because he has the responsibilities to take care of his little brothers. His mother doesn't spend time enough time with him and his little brothers. Salvador has many negative thoughts; he has too much stress from school and home. The causes from his situation are that because he is very shy and doesn't have the guts to talk to others and make new friends, he is lonely so he doesn't talk in class. His mother is busy all the time taking care of the baby, so she left a lot of responsibility to Salvador. Giving responsibility to a child is good so they will be more matured, but the mother is giving him too much responsibility that she is abusing the use of Salvador. The effect of Salvador’s situation is his social life, because he doesn’t get to have the time to make friends and go play sometimes and he has to take care of his brothers. Not having friends in class makes him really lonely and quiet and so the teacher doesn't remember his name. If he has to still live on like this and his mother won’t change, he will become a

Finance and its importance In the Business world Essay

Finance and its importance In the Business world - Essay Example Usually corporations only give 7 days credit term at most is 15 days credit term. If it will go more than that then they have to seek bank loans in order to provide buffer or answer the shortfall of cash for its operating cost. A lending company has available funds for $300.00. The average amount borrowed in a month is usually $200.00. If in case, one borrower name Sally cannot pay the amount of $100.00, they still has a buffer left in the amount of $100.00. In case the borrowings on that week go as high as $300.00, then they are going to the bank to make a short term loan in lower interest rate. This thereby affects their income since the interests that they paid with the bank already eat up a portion of the income that they generate out of the transaction. Still they have to put up the funds, otherwise they cannot maintain their line of borrowers. It is the idea of financing of contingencies and seasonal peaks in working capital. Inventory is the art of warehousing. It entails a list of the raw materials, equipment and parts, office supplies needed to run the business or production without faltering. The list is readily available at the stores section or at the warehouse for the requisition of other departments.

Provision 7 case study Example | Topics and Well Written Essays - 250 words

Provision 7 - Case Study Example Therefore, Melisa should devise an effective strategy to address the problem before it gets out of hand. The interaction of the instructor and the student will bear some influence on behavior perception. In this regard, Melisa should be vigilant when relating with the students to avoid development of negative attitude by the students. There are many approaches that the instructor can use to solve the problem facing the student and other difficulties facing the entire students’ body. For instance, the instructor can call the student in a private room or an open field where they are just the two of them and dialogue about the problem facing the student. Doing this gives the student assurance that the conversation is secure and that personal information cannot leak to a third party. After identification of the problem, the nursing instructor should prescribe the appropriate method of handling the problem. In addition, the instructor should refer the student to a professional counsellor to facilitate effective solution of the problem. In summary, nursing instructors should always be prepared to address both simple and complex problems facing the students, in addition, nursing instructors should engage in regular training to enhance development of diverse

Terrorism Essay Example | Topics and Well Written Essays - 1000 words - 1

Terrorism - Essay Example Terrorist acts committed by women and children are becoming a widespread phenomenon. Joann Chesimard is a perfect example. Terrorist groups understand that it is much easier to commit a terrorist act if you are a charming woman or a little child. People usually do not tend to suspect women and children in being capable of committing a violent act. Thus, terrorists can reach their goals easier. Certainly, the representatives of fair sex, and especially little children, can be criminals and victims at the same time, because many of them are forced to commit terrorist acts or they can be imposed upon by some religious believes with this purpose. (Hoffman, Inside terrorism 3). 2. Hezbollah brought too much violence to the world in the past, so its present activity must also be considered as violent. Terrorist organization is the one that uses terror to achieve certain goals, but terror may have different forms (Hoffman, "The Logic of Suicide Terrorism"41). Notwithstanding that now the or ganization does not commit terrorist attacks, it still wants to have much power by controlling its own TV stations and news channels. Terrorists try to impose their influence on different governments that testifies about their desire to have much power. People should not trust the individuals who were terrorists in the past. Their behavior may turn to violent any moment, thus, European Union is quite right blacklisting them. 3. If we talk about the difference between the terrorism in Europe and in the United States, we should recognize that the terrorism itself and the tactics of struggling with it are very different in both continents. The difference is connected with the way terrorism is treated and the history of terrorist attacks. It is a well-known fact that the goal of the United States is to influence Muslims and impose western values upon them. The goal of the US is very understandable as Muslims’ behavior is sometimes cruel and violent, so it would be better if they accept some western values. However, Muslims value their culture and religion very high and are not going to lose their values or substitute them. They got used to the way of life they conduct, thus, they try to resist the imposed changes. For example, the terrorist act of September 11, 2001, was the Muslims’ response to the United States politics in their countries. Thus, the main goal of the United States regarding terrorism is not to prevent further attacks, but to defeat terrorism as a phenomenon, to eliminate terrorist groups in the bud (Campbell 2). Speaking about Europe, the attitude to terrorists there is very different. If the United States, as a more democratic country, tries to help Eastern countries become more developed, Europeans are just proud of their culture and consider it to be much better than a Muslims’ one. Therefore, Europeans consider terrorism to be the act of the â€Å"wild† part of the world against civilization. Thus, the tactics of s truggling with terrorism in Europe is directed on providing Europeans with necessary protection and on the prevention of further attacks. Thus, it we talk about terrorism, we should recognize that the politics of the United States is more aggressive due to the number of reasons, while the politics of Europe has a somewhat defensive character. 4. The main task of mass media is to

Colombias Generally Accepted Accounting Principles Analysis

Colombias Generally Accepted Accounting Principles Analysis Columbian GAAP According to the Constitution of Colombia, only Congress has the authority to issue generally accepted accounting principles. Through legislation, however, Congress can delegate this authority to the executive branch as well as to other institutions. The Central Board of Accountancy was formed to regulate the accounting profession (Colombia, 2010). Under this board, the Technical Council for Public Accounting was created. The Technical Council was designed to issue guidance on accounting standards, and it was this council that issued Colombias generally accepted accounting principles (GAAP) (Accounting Standards Update by Jurisdiction, 2010). Colombian GAAP is based on US GAAP and International Accounting Standards (IAS). It is important to note, however, that Colombias accounting standards have not been updated since 1993, so they do not reflect any updates or advancements in international or US standards (Colombia, 2009). The Colombian Congress also allowed regulatory agencies to issue their own accounting standards to help them perform their jobs (Accounting Standards Update by Jurisdiction, 2010). Because the nation has several agencies that each issue different accounting rules for the organizations under their jurisdiction, the World Bank criticizes Colombia for not having general-purpose financial reporting. There are currently forty-three different sets of accounting standards in the nation. The World Bank is also concerned that the Central Board of Accountancy is not receiving enough funding to complete its job thoroughly and efficiently. Moreover, the World Bank is concerned that Colombias code of conduct for accountants is not consistent with the code of the International Federation of Accountants (IFAC). (Colombia, 2009). There are no auditing standards that are enforceable by law in Colombia. Additionally, there is no law mandating the independent audit of financial statements (Taxes-Accoun ting, 2010). Accounting for the Public Sector National General Accounting Office Accounting standards and principles for the public sector of Colombia are provided by the National General Accounting Office. Furthermore, the Office standardizes and consolidates accounting information and is ultimately responsible for preparing the Nations Consolidated Balance Sheet. The National General Accounting Office is also responsible for outlining what financial statements need to be produced by the public sector (Contaduria General de la Nacion, 2009). Required accounting reports include balance sheets, income statements, operational balances, and annexes (Taxes-Accounting). The Office will provide the public sector with explanations on the timing and standards that the financial statements must satisfy (Contaduria General de la Nacion, 2009). Accrual Basis Colombias public sector accounting standards are currently and successfully in the process of convergence with the accrual-based International Public Sector Accounting Standards (IPSAS). Because Colombias public sector standards were already primarily accrual-based, the nation did not have to undergo tremendous reform to converge with IPSAS. Colombia was extremely eager to align its accounting standards because the nation understood the need for standardization with economic globalization continuing to intensify (Benavides, 2010). Tax Environment Value Added Tax Colombia has a value added tax of sixteen percent as its form of consumption tax (Taxes-Accounting, 2010). Differing from a sales tax where only the end consumer is charged, a value-added tax is charged at each stage of the production process (value-added tax). There are lower value added taxes for commercial air transportation and food products at ten percent and seven percent respectively. Insurance products and medical care products are completely exempt. Colombia has two other forms of consumption tax, including an excise duty that is levied on alcohol and cigarettes. The nations custom service also charges a tax of 1.2% on imports from other countries. Nations that have signed trade agreements with Colombia are exempt from the import tax (Taxes-Accounting, 2010). Corporate and Personal Income Taxes The personal and corporate tax rates of Colombia are some of the highest in Latin America (Department of State). The nation charges a corporate income tax of thirty-three percent on all companies except for those located in the free-trade zone. Those companies are only charged fifteen percent. A unique aspect of Colombias corporate tax system is that most capital gains are charged at the ordinary rate. Capital gains that are exempt or taxed at a special rate are in the minority. Not uncommon, depreciation and depletion expenses are deductible. Net operating losses, expenses abroad, and specific taxes are some of the other commonly deductible items. For individuals, Colombia has a progressive tax system that ranges from zero to thirty-three percent. Colombias tax system measures individual income using Tax Value Units (UVT) (Taxes-Accounting, 2010); one Tax Value Unit is equal to 24,555 Colombian Pesos (Colombia Tax Rates, 2010). The individual income tax progresses through four levels: zero percent, nineteen percent, twenty-eight percent, and thirty-three percent. All taxpayers that have greater than 4,100 UVT are charged a thirty-three percent income tax rate (Taxes-Accounting, 2010). IFRS Compliance with IFRS Colombian GAAP has not been updated since 1993, so the World Bank recommends that Colombia adopts International Financial Reporting Standards in their entirety and that the nation creates a High Council to manage and oversee this process. Furthermore, the World Bank would like Colombia to create a body that enforces these accounting and auditing standards. From 2007 to 2009, the Colombian Congress has been agonizing over a bill that would mandate all large companies in the nation to fully adopt IFRS by 2010. The bill would also stipulate that small to medium companies adopt IRS by 2012 (Colombia, 2009). However, in 2009, the Colombian Congress enacted a bill that only calls for the convergence of Colombian GAAP with IFRS, as opposed to the complete adoption of IFRS. Standards Compliance Index Currently, according to the Financial Standards Foundations Standards Compliance Index, Columbia has only obtained a score of 40.83 out of 100 and ranks 48 among other countries for compliance with international standards. The nation is successful with data transparency and macroeconomic policy compliance but needs to work on remedying the transparency of its fiscal policy. Columbia has struggled with the latter because of difficulties managing the budget both regionally and municipally. The nations weakness in financial regulation and oversight has had the greatest negative impact on the Standards Compliance Index (Colombia, 2009). This is clearly a result of the lack of auditing standards and the lack of required independent financial audits (Accounting Standards Update by Jurisdiction, 2010). Columbia scored relatively well in accounting and auditing standards because of the evolution of legislation that dedicates the country to converging its present auditing standards with inter national standards (Colombia, 2009). Auditing Standards In the World Banks assessment of Columbia, the institution was concerned over the nations lack of auditing standards. The International Monetary Fund also found that Columbia did not comply with international auditing standards. Furthermore, the World Bank was disturbed that external audits are not mandatory and that the concept of independence does not even exist in Columbia. The World Bank concluded that, in Colombia, the legislative requirements on auditing contradict the modern concept of financial statements audits' (Colombia, 2009). In this nation, auditors also act as controllers, and the latter role should only be assumed by management to follow suit with international principles. As a result, the World Bank recommended that Columbia adopt International Standards on Auditing (ISA) and develop new legislation that will create regulations for auditors and improve auditing requirements. The legislation should also create an organization that would oversee auditors and enforce au diting standards. To further improve the strength of its auditing profession, Columbia should improve the licensing requirements for auditors and provide training programs on International Standards on Auditing. The nation should also create a professional organization that encourages the independence of auditors (Colombia, 2009). Columbia is currently in the process of converging its auditing standards, or lack thereof, with international requirements.

An Unsuitable Job For A Woman: Two Detectives :: essays research papers

While reading, An Unsuitable Job for a Woman, by P.D. James and Indemnity Only, by Sara Paretsky, one is given the opportunity to slip in to the life of a female private detective and experience the aspects of what occurs during the process of a murder investigation as seem through the eyes of two very independent women. P.D. James’s character of Cordelia Gray and Sara Paretsky’s character of V.I. Warshawski are two private investigators that display great passion for their jobs and will stop at nothing in order to close their cases. But, are inexperienced Cordelia Gary and wisecracking Warshawski prime examples of private investigators or are they two naà ¯ve women who have entered an occupation where compassion and sympathy are two traits that are better left unused. Both Cordelia and Warshawski display great ability as women to enter a world of hate, lies and murder and take on roles that traditionally only men dared to enter. But, as they sift though evidence left behind by unknown assailants and pry into the lives of dead and living strangers, are these women really living lives of their own or are they becoming to emotionally entangled in a web of self destruction. Putting their lives in harms way in search of justice, an oath that they as private detectives have never took. Both women are clearly excellent detectives; they solved their cases and reaped the self-gratification that comes from hard work and determination. In spite of that, are these two women really doing themselves any justice by restraining from the certain pleasures in life they yearn to experience and enjoy but have sustained from due to the career choice they have chosen, as seem in Cordelia’s reflection of what her life may have been like if she had chosen to attend an university and Warshawski’s reflection in the park of the mother and her children. Both women are still at an age where these reflections can still become reality, yet they have chosen to continue pursuing a career that hampers their ability to achieve these personal goals. Maybe their becoming to emotionally involved in their cases is a result of their search for a way to compensate for the void their career choice has left in their lives. Both Cordelia and Warshawski became a little too preoccupied with their cases. Cordelia became so involved she was sleeping in the same house in which the murder occurred, not to mention the same bed as the deceased and she even began wearing the clothes of the young man whom she was investigating the murder of.

China Global Imbalances, Reserve Currency and Global Economic

Global imbalances, Reserve currency, and Global economic governance The accepted hypotheses for the root cause of global economic imbalances are: 1)East Asian economies’ export-led growth: recently the integration with international markets leads to an import and export expansion making the trade surpluses in EA dramatically increase. It had a great success in EA producing higher living standards and poverty rates declining. This cannot be the main cause for the emergence of large global imbalances in 2000 and thereafter since before 2000 EA economies’ TB were roughly balances. )Self-insurance motivation for foreign currency reserve accumulation: after the financial crises in the late 1990s, emerging market economies in EA increased their CA surpluses substantially, and they experienced rising international reserves. After 2005 Chinese surpluses and reserves are too large to be justified by the self-insurance motivation. 3)China’s exchange rate policy: the g. i. started to grow in 2002 and China has been accused of causing the imbalance sustaining a large undervaluation of its real exchange rate since 2003, but it is not true because: †¢China trade surplus did not become large until 2005 RMB appreciated against US$ by 20% in 2005-2008 but the global imbalances continued to grow †¢Most other developing countries also increased their CA surpluses in the same period (if exchange rate was the cause, the other countries that compete with China would have experience declining trade surpluses and reserves) >The need for an alternative hypothesis: these hypotheses imply that the EA economies are driving the g. i. but is not consistent with the basic statistics.While the US trade deficits with China did increase substantially, the share of the US trade deficit due to EA economies as a region actually declined significantly. The three hypotheses surely contributed but they cannot be the main cause of the global imbalances. >An alternative h ypothesis consistent with the data: it views the g. i. as a result of the status of the US $ as the major global reserve currency, combined with: †¢The lack of appropriate financial sector regulation due to deregulation in the 1980s. The federal reserve’s low interest rate policy following the burst of the â€Å"dotcom† bubble in 2001. These policy changes led to excessive risk-taking and higher leverage, producing excess liquidity and â€Å"bubbles† in the US markets, which enabled the US overconsumption that increased the US CA deficit. As China had become the major producer of labor-intensive processed consumer goods by 2000, the US ran a large deficit with China, which ran trade deficits with the EA economies that provided intermediate products to China.The excess liquidity also led to the large outflow of capital to developing countries, which enhance their investment and consequently in large trade surpluses in capital-goods exporting countries and na tural resources exporting countries. Since the US is the reserve currency issuing country, the foreign reserves accumulated through trade/capital account surpluses in other countries would return to the US leading to the US CA surplus. >Why did China stand out in the global imbalances? : the large CA surplus in China reflects high domestic savings.There are several commonly accepted hypotheses about China’s high households saving rate: such as the lack of well-developed social safety net and the demographics of an aging population. But the uniqueness of China’s savings is the large share of corporate savings, which are driven by the excessive concentration of the financial system that serves the big firms, low taxation on natural resources, and monopolies in some sectors. Reforms are required for removing these distortions and increasing consumption. The role of the reserve currency in global imbalances: the status of the $ as the major global reserve currency, combine d with the financial deregulation of the 1980s and the low interest rate policy of the 2000s, led to the emergence of global imbalances. To prevent their recurrence, the ultimate solution is to replace national currencies as global reserve currencies with a new global currency, but US is unlikely to give up its reserve-issuing privilege to a global body (IMF).A more likely scenario is the emergence of a basket of reserve currencies with some changes in the basket’s consumption and weights. >A win-win solution for the global recovery: the most urgent challenges are high unemployment and the large excess capacity in high-income industrialized countries. Win-win solutions for the global recovery and long-term growth could be based on new international financial arrangements along with structural reforms in both high-income and developing countries.On the financial front it could be created a global recovery fund (supported by hard-currency countries and large-reserve countries a nd managed by multilateral development banks) to finance investments to release bottlenecks and enhance productivity in developing countries. These investments would increase the demand for capital goods produced in high-income countries, reduce their unemployment now, and enhance the developing countries’ growth in the future. The fund could be complemented by structural reforms in high-income and developing countries to create space for investment and to improve the efficiency of investment.

Media. Music. You. essays

Media. Music. You. essays In our society today, people are influenced by many different things. The media uses advertisements and commercials to sell us what we think we need in order to fit in. This type of media hype is everywhere; in our magazines, on our television screens, on billboards, and in our music. Yes, music does control society in some aspects. Little girls idolize pop stars, and young men look up to the clever lyricists in our popular culture. Yet, sometimes these role model artists are not sending the right messages to young adults. Girls may judge what a man should be based on her current pop star crush, and guys may judge girls in the same way. Not all boys can be Justin Timberlake, and not all girls can be Britney Spears. This should not be the message to young people in the first place; they should listen to artists who present diverse issues in their music, so the young minds of these teenagers can form their own opinions about the world. The media and the big corporations that own the r ecord companies place such a big hype on certain artists that some people may not take the time to dig deeper and find genuinely good music, or to see what underlying issues are taking place in the music industry. There is a website called Downhillbattle.org that provides information for music activists; the site shows the world how the big record labels are controlling the radio music play and how artists get paid close to nothing compared to how much the big corporations make. One of the ways Britney and Justin are made into pop idols is through a system in the music industry call pay-for-play. In an article by Eric Boehlert called Will Congress tackle pay-for-play? the issue of Congress finally stopping the big record companies from paying out the radio stations is discussed. ...It virtually shuts off access to commercial FM radio for artists or record companies who can't or won't spend hundreds of thousands...

Vatican City Is an Independent Country

Vatican City Is an Independent Country There are eight accepted criteria used to determine whether an entity is an independent country (also known as a State with a capital s) or not. Let us examine these eight criteria in regard to the Vatican City, a tiny (the smallest in the world) country located entirely within the city of Rome, Italy. The Vatican City is the headquarters of the Roman Catholic Church, with over one billion adherents worldwide. Why the Vatican City Counts as a Country 1. Has space or territory that has internationally recognized boundaries (boundary disputes are OK.) Yes, the Vatican City’s boundaries are undisputed even though the country is located entirely within the city of Rome. 2. Has people who live there on an ongoing basis. Yes, the Vatican City is home to approximately 920 full-time residents who maintain passports from their home country and diplomatic passports from the Vatican. Thus, it is as though the entire country is composed of diplomats. In addition to the over 900 residents, approximately 3000 people work at the Vatican City and commute into the country from the greater Rome metropolitan area. 3. Has economic activity and an organized economy. A country regulates foreign and domestic trade and issues money. Somewhat. The Vatican relies on the sale of postage stamps and tourist mementos, fees for admission to museums, and the sale of publications as governmental revenue. The Vatican City issues its own coins. There is not much foreign trade but there is significant foreign investment by the Catholic Church. 4. Has the power of social engineering, such as education. Sure, although there aren’t a lot of kids there! 5. Has a transportation system for moving goods and people. There are no highways, railroads, or airports. The Vatican City is the smallest country in the world. It only has streets within the city, which is 70% of the size of the Mall in Washington D.C. As a landlocked country surrounded by Rome, the country relies on the Italian infrastructure for access to the Vatican City. 6. Has a government that provides public services and police power. Electricity, telephones, and other utilities are provided by Italy. The internal police power of the Vatican City is the Swiss Guards Corps (Corpo della Guardia Svizzera). External defense of the Vatican City against foreign enemies is the responsibility of Italy. 7. Has sovereignty. No other State should have power over the countrys territory. Indeed, and amazingly enough, the Vatican City does have sovereignty. 8. Has external recognition. A country has been voted into the club by other countries. Yes! It is the Holy See which maintains international relations; the term Holy See refers to the composite of the authority, jurisdiction, and sovereignty vested in the Pope and his advisers to direct the worldwide Roman Catholic Church. Created in 1929 to provide a territorial identity for the Holy See in Rome, the State of the Vatican City is a recognized national territory under international law. The Holy See maintains formal diplomatic relations with 174 nations and 68 of these countries maintain permanent resident diplomatic missions accredited to the Holy See in Rome. Most embassies are outside of the Vatican City and are Rome. The other countries have missions located outside Italy with dual accreditation. The Holy See maintains 106 permanent diplomatic missions to nation-states around the world. The Vatican City/Holy See is not a member of the United Nations. They are an observer. Thus, the Vatican City does meet all eight criteria for independent country status so we should consider it as an independent State.

4 Questions Essay Example | Topics and Well Written Essays - 500 words

4 Questions - Essay Example For instance, the introduction of diet soft drinks offering low amounts of sugar is indicative of a social trend whereby consumers have increasingly become health conscious. These elements are crucial for any business and hence should be taken into account and business policies should be adapted according to such changes in lifestyle of people to sustain their competitive positioning in the industry. The businesses on the other hand should also take into consideration the implications of their products and develop them accordingly. For instance the increasing trend of environment protection and global warming has led to manufacturing of environmental friendly products such as Toyota’s hybrid car – Prius. Political elements such as government legislations in favor or against a particular goods / service can greatly influence the manufacturing and marketing of that product causing severe damage to its profitability. These political elements are likely to have more significant impact on industries which are highly dependent on governmental aids such as budgets and subsidies. For instance, the Aerospace and Defense industries are highly influenced by defense budgets allocated by the government as well as the political relations between certain countries. This can affect the major players in the industry such as Boeing, EADS , Dassault Aviation etc. The advancement in technology brings about several changes in the marketing of products of a company. The various technological tools available offer different ways to approach the same needs and demands of the customers making the competition extremely fierce. Increased technological advancement also often leads to faster obsolescence of products. The demand for a particular technology is dictated by the markets and hence required to be adopted by companies providing such products in order to sustain their revenue flows. The sheer number of players available in the market would lead to customer switching and hence

Labor Pool Challenges Essay Example | Topics and Well Written Essays - 500 words

Labor Pool Challenges - Essay Example For example, in the 21st century, 60% of new jobs require one to have at least post-secondary education. Contrarily, an estimated one third of America’s workforce has attained this level of education (Lebergott, 2014). The continuous process of innovation as well as technological changes has resulted in the motor vehicle industry related jobs demand even higher skill levels. According to United States Department of Labor (2015), the use of computers and Internet has redefined and reorganized work skills required at the workplaces. Most jobs now require education and training. As cited by Cascio (2012), structural unemployment results because of the mismatch of skills of the unemployed persons and the skills required for the available job. Evidence has demonstrated that the percentage of the workforce having graduated with college degrees is growing at a very slow rate. It has also been projected that in the next two decades, there will be virtually no growth in the prime age workforce; 25-54 years. This would result in a substantial reduction in skill growth. With few people having the required skills and education, there is insufficient supply of skilled in the labor pool for the automobile sector. In a view shared by Farmer, people with higher education levels face very low rates of unemployment. He reported workers aged 25 years or more, the unemploy ment rate was 4% for those with a bachelors degree or higher, 6% for those with a degree, 9% for high school graduates; and 12% for those with less than a high school diploma (Farmer, 2011). A can manufacturing or distribution firm with insufficiently trained labor force faces high turn over, low levels of employee performance, low productivity, high accident rates, improperly administered facilities, and improper resource allocation, as well as lack of

What effect does the financial crisis have on the luxury fashion Essay - 1

What effect does the financial crisis have on the luxury fashion market - Essay Example Companies are looking forward to commence with some sort of strategies which would help them to retain their revenue and sustain in such economic turbulence. The predictions have been made that financial woes would continue for few years and will deflate consumer spending even more. (your statement) Â   The term financial crisis is largely used when the financial institutions lose a large quantity of their value. The financial crisis is allied with banking panics, stock market crashes, bursting of financial bubbles, currency crisis and sovereign defaults. The global financial calamity started in July 2007, when around the world stock markets collapsed, and the financial institutions plunged. The governments started to release some effective packages in order to save their financial systems. The investors became frightened by the abrupt decline in the stock market, which reduces their investments in the market. A luxury good is a good for which the demand of the consumer increases as the income level increases. Luxury goods have always been a symbol of prosperity and wealth for ages, for the spendthrifts, who desire and enjoy buying. Owning and wanting to be the owner of luxury items such as the latest designer clothes, jewelry, watches, is a pleasure on its own. Items that comes with a heavy price tag than ordinary items and have a known brand name is identified as luxury item. In economics, luxury goods have said to have high elasticity of demand, which means that when buyers become wealthier they would like to spend more and more cash on the luxury items. It also means that when there is a turn down in income level there will be a decrease in demand. Both income and demand are directly proportional to each other, if one increases the other rises as well and vice versa. Income elasticity of demand is not constant with respect to income, and the demand may changes at different income leve ls. That is to say, a

Iran continues to bravely slam USA and its closest ally, Israel Essay Example for Free

Iran continues to bravely slam USA and its closest ally, Israel Essay The news is about the UN decision to invite President Mahmoud Ahmadinejad of Iran to the food summit in Rome Italy. It features the reaction of Israel’s President Shimon Peres claiming that Ahmadinejad’s appearance on the summit would distract attention from problems of hunger in the world. The reaction of President Perez stemmed from the statement of Iranian President that Israel was â€Å"doomed to go. † The news also quoted the statement of Rafsanjani, another top official of Iran stating that Iran and other Muslim nations must stop the USA from enslaving Iraqis. Rafsanjani commented that the US-led occupation of Iraq represents a danger to all nations of the region. He said that Washington and Baghdad try to put Iraq under their spell through a long-term security agreement but Rafsanjani contends that the essence of this agreement â€Å"is to turn Iraqis into slave before the Americans, if it is sealed† Rafsanjani stated that the Iraqi people and the Islamic nation will not allow it. † Both Ahmadinijad and Rafsanjani have been featured in many internet articles as loyal to Islamic fundamentalist cause. In fact, one those articles even went on to say that Ahmadinijad is a â€Å"self proclaimed religious fundamentalist. My opinion about the news is that Iran is simply attracting Islamic countries to rally behind their anti-Semitic stand. It is apparent that Islamic fundamentalist are deeply anti Semitic and are against the west not only in their export of western culture and western style democracy, but because the West are obviously supporting Israel. Ahmadinejad is taking advantage of every opportunity to express their views on US Israeli affairs before an international gathering obviously for its own propaganda designed to draw sympathy against the US. While it may be true that the US may its own interest in maintaining its presence in Iraq, but I would say that Mr. Rafsanjani statement is out of bounds intended only to make matters worse for the US, before the international audience. Iran probably has an axe to grind against the US because of its support to Iraq during Iran Iraq war. Arabs and Islamic Fundamentalist opinion has flamed against the United States because of its unwavering support to Israel who has dispossessed the Palestinians of their settlement in Jerusalem. Iran’s hatred of Israel is deeply enshrined in their nationalism and cultural emphasis. The statement therefore voiced by two of the highest Iranian officials is not based on objective criticism but is only a political ideology. Concerning the feeling of anti- Semitism, Iran is not alone in their hatred to Israel, as earlier century have seen the expulsion of the Jews in some countries like Spain and England, two of the many countries who expelled the Jews. All of those expulsion happened long before the Israeli- Palestinian conflict had started. However, Mr. Ahmadinejad must learn to recognize the danger of provoking the remaining super power to turn its back against Iran. Iran must look at the case of Iraq and try to figure out the worst-case scenario. Today, many countries are working very hard in the concept of globalization, and high technology equipment. These countries are today the fastest growing economies. For Iran to cache up with these developments, Iran should better stop thinking of annihilating the Jews, but start working cooperatively and mutually with every country particularly Israel and the United States.

Immune System of a Plant

Immune System of a Plant ABSTRACT Two light signalling factors, FAR-RED ELONGATED HYPOCOTYL3 (FHY3) and FAR-RED IMPAIRED RESPONSE 1 (FAR1) regulate chlorophyll biosynthesis, seedling growth and modulate plant immunity by controlling HEMB1 expression in Arabiopsis thaliana. We show that fhy3 far1 double null mutants display high levels of reactive oxygen species, salicylic acid and high expression of pathogen related genes. We analyse the effects of this constitutively activated immune response on commensal microbial communities through use of a next generation sequencing based approach. We determine that fhy3 far1 mutants contain greater species diversity and a greater resistance against pathogenic bacteria. Fungal pathogens increase in abundance in fhy3 far1 mutants. Taken together, this study demonstrates the important role of FHY3 and FAR1 in commensal microbial community composition as well as the importance of bacterial fungal relations. INTRODUCTION The Microbiome Microorganisms are an extremely diverse group of organisms; making up an astonishing 60% of the Earths total biomass (Singh, 2009). Soil sustains as many as 4-51030 microbial cells (Singh, 2009), all contributing to soil structure formation, decomposition, and recycling of organic matter into its constituent elements and nutrients. Microorganisms present in the soil adjacent to plant roots are part of the Rhizosphere. (Garbeva, 2004) highlights their pivotal roles in the suppression of plant disease (Badri DV, 2009), promotion of plant growth (Lugtenberg, 2009), development and health (Mendes, 2011). Leaves usually dominate the aerial part of the plant, representing of the most significant terrestrial habitats for microorganisms: the Phyllosphere (Vorholt JA, 2012). A diverse community of bacteria and fungi inhabit this challenging habitat; with nutrient deficiency and fluctuations in temperature, humidity and UV radiation (Lindow SE, 2003). The microbial communities here are shaped by biotic factors: (Yang CH, 2001) states that species, genotype (van Overbeek L, 2008) and age of plant (Redford AJ, 2009) all have their respective impacts. Abiotic factors also have a profound influence over the communities present within the phyllosphere. Plant location and growth conditions such as soil composition and climate can also have a strong impact due to the physiochemical alterations they impart. (JH, 1999) also notes how plant genotype and phenotype has an impact on community assembly. Although the majority of communities exist on the plant surface, and are therefore epiphytic some exist within the plant as endophytes. Species present within the phyllosphere tend to assimilate plant derived ammonium, simple carbohydrates and amino acids, which are their primary nitrogen and carbon sources (Thomas R Turner, 2013). Microorganisms energy metabolism isnt entirely dependent on the plant; some species contain rhodopsins. Due to the abundance of processes which play a role in community composition (Weiher E, 2011), phyla with the best adaptations for survival and reproduction tend to predominate communities. These microorganisms can promote plant growth through the production of hormones, or protect plants from pathogenic organisms by producing antibiotic compounds, competing for resources (Berg G, 2009) or induction of systemic resistance (Conrath U, 2006). The use of Arabidopsis thaliana as a model organism has been vital for these studies (Innerebner G, 2011). A. thaliana is an annual forb, occurring at temperate regions worldwide in a diverse range of habitats (Elena Garcà ­a, 2013) In order to analyse microbial communities; a few terms need to be defined. Biodiversity is defined as the range of significantly different types of organisms and their respective relative abundance within a community, encompassing three main levels; genetic variation between species, number of respective species and community or ecological diversity (Harpole, 2010). Two main components make up species diversity: the total number of species present (species richness) and the distribution of individuals amongst said species (evenness). Operational taxonomic units (OTU) or communities provide information on an ecosystem (Mannan, 2013). Species diversity relates to the stability of a community; well organized communities tend to have the greatest stability (Yannarell, 2005). Stresses can cause disturbances in a homeostatic community, thereby disrupting it and leading to changes in species abundances. When characterizing an ecosystem such as A. thaliana, one must determine three things: T he type of microorganisms present, their roles and how these roles relate to the ecosystems function (Sani, 2011). Plant Immune Response The immune system of a plant has a selective effect upon its microbiome. Upon pathogen encounter, a plant will elicit an immune response with the goal of limiting pathogen growth. Biotrophic and hemibiotrophic pathogens (those who obtain nutrients from living host tissue) are repelled by Salicylic acid dependent defence responses. Necrotrophic pathogens (which kill their host to obtain nutrients) are sensitive to Jasmonic acid (JA) and Ethylene (ET) dependent defence responses (Christine Vogel, 2016). Plants lack specialised immune cells; therefore, their cells must have an ability to sense pathogens and mount an appropriate immune response. Pathogens are detected by pattern recognition receptors (PRRs) which bind to the microbe or pathogen associated molecular patterns (MAMP/PAMP), thereby issuing a layer of basal defence known as PAMP triggered immunity (PTI) to prevent pathogen colonization (Chuanfu An, 2011). In order for pathogens to cause disease, they must inject effectors int o plant cells, thereby interfering with PRR complexes or downstream signalling to overcome the PTI. Plants have evolved resistance proteins which recognise effectors directly or indirectly and induce effector triggered immunity (ETI). This response is far more specific, and is often followed by a hypersensitive response (HR). R proteins, mostly leucine-rich repeat (LRR) domain containing proteins and Nucleotide-binding (NB) proteins are the intracellular receptors which sense pathogen derived molecules (Heidrich K, 2012). Figure 1 shows a summary of these processes. When these proteins are activated, production of salicylic acid occurs. Salicylic acid (SA) is a phenolic phytochrome present in plants. SA holds roles in growth, development, transpiration, photosynthesis and the uptake of ions. Its also vital for the process of endogenous signalling, mediating plant defence against pathogens. Activation of defence signalling pathways causes the generation of mobile signals from the infected tissue, where they can spread to distal tissue. Here they can upregulate expression of pathogenesis related genes and induce systematic acquired resistance (SAR), a long-lasting immunity against a broad spectrum of pathogens. Sali cylic acid mediated immune responses are important factors of both PTI and ETI, essential for the activation of SAR. NB-LRR mediated disease resistance may only be effective against pathogens grown on living host tissue such as obligate or hemibiotrophic pathogens, but not against nectrotrophs (Dangl, 2006). Downstream of the NB-LRR R proteins, the pathways ENHANCED DISEASE SUSCEPTIILITY1 (EDS1) and its partner PHYTOALEXIN DEFICIENT 4 (PAD4) act in basal resistance and ETI initiated by Toll-like/Interleukin 1 receptor (TIR) type NB-LRR R proteins (Vlot AC, 2009). Both PAD4 and EDS1 amplify SA signalling through a positive feedback loop (Wanqing Wang, 2015). Coiled-coil (CC) type NB-LRR proteins are regulated by NONSPECIFIC DISEASE RESISTANCE 1. When SA levels increase as a result of pathogen challenge, redox changes are induced which cause reduction of NON EXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) to a monomeric form which activates defence responsive gene expression by accumulating within the nucleus. This results in plant immunity (Fu ZQ, 2013). Most bacteria which colonize A. thaliana are not pathogenic however still produce MAMPs. It is currently not known how plants are able to tell apart pathogenic and commensal microorganisms, and whether the recognition of these non-pathogenic phyllosphere bacteria triggers plant immune signalling networks downstream of PTI or ETI activation, with knock on effects on community structure. (Christine Vogel, 2016) determined that in response to some non pathogenic species, the detection of MAMPS leads to no change in gene expression. Note that some species of bacteria can induce transcriptional changes to protect the plants from infections of other species (Judith E. van de Mortel, 2012). FHY3 FAR1 Plants have developed regulatory mechanisms in order to cope with adverse abiotic and biotic conditions (Bray EA, 2000), however these are a detriment to their growth and development. These regulatory mechanisms activate immune responses and resistance pathways in the case of biotic stress. Constitutive activation of plant immunity would lead to impaired growth and fitness, so in the absence of stress, the immune response must revert the massive transcriptional reprograming, requiring tight genetic control (Tian D, 2003). Arabidopsis thaliana has to adapt to changes of environmental stimuli, such as light signals or temperature. Light duration, direction, wavelength, and quantity are determined by a battery photoreceptors which monitor incident red (R, 600-700 nm) and far red (FR, 700-750 nm) light wavelengths. This is achieved by switching between R absorbing and FR absorbing modes through biologically inactive Pr and active Pfr forms (PH, 2002). Photo activation of the primary photoreceptor for FR light phyA, causes translocation from the cytoplasm to the nucleus. This translocation allows induction of FR-responsive gene expression required for various photoreceptors. Two pairs of homologous genes are essential for the phyA signalling; FAR1 (far-red-impaired response 1) and FHY3 (far-red elongated hypocotyl 3). (Hudson, 2003) determined that these genes encode mutator like transposase derived transcription factors which directly bind to the promotor region HEMB1, which itself encodes a 5-1minolevuli nic acid dehydratase, ALAD) and activates its expression, thereby regulating both chlorophyll biosynthesis and seedling growth (Tang W, 2012). These regulators small plant specific proteins, which are necessary for the nuclear accumulation of light activated phyA. (Wanqing Wang, 2015) determined that fhy3 far1 double null mutants display an autoimmune response; accumulating SA and ROS, inducing PR genes and having an increased resistance to pathogen infection. They all displayed a dwarf phenotype, with necrotic lesions developing on their leaves as a result of premature cell death. Wang and his colleagues determined that FHY3 and FAR1 may act as defence-responsive gene repressors; mutants had high abundances of R genes and upregulated levels of PR genes, hinting at a possible link with regulation of NB-LRR mediated SA signalling pathways. Fhy3 far1 mutants increased expression levels of EDS1, PAD4, SID2 and EDS5 all genes involved in SA pathways. Reduction of HEMB1 in fhy3 far1 lead to a constitutively activated immune response, inducing system acquired resistance. (Wang Q, 2007) hypothesized that FHY3 and FAR1 may negatively regulate SA signalling and plant immunity through regulation of HEMB1 expression providing a possible linkage between light signalling and plant immunity. Next Generation Sequencing Most microbial communities present within nature are yet to be cultured within a laboratory; thereby leaving biomolecules such as nucleic acids, proteins, and lipids as our only source of information. For phylogenetic studies, surveys of the small ribosomal subunits (SSUs) for bacteria and the internal transcribed spacer (ITS) region of fungi are vital. Ribosomal genes are present in all organisms and contain regions which evolve slowly, coupled with faster evolving regions which permit fine tuning of taxonomic levels, to either family or genera. Note, that there also exists numerous databases for reference sequences and their respective taxonomies, such as SILVA (Pruesse, 2007) and the Ribosomal Database Project. This technique uses multiple primer pairs for each of the marker genes, each associated with its own taxon (William Walters, 2015). SSU rRNA genes are the standard reference sequence for taxonomic classification; calculating similarity between rRNAs. ITS regions are primari ly sequenced for fungi due to the higher degree of variation they display as a result of low evolutionary pressure, and clear resolution below genus level (Bellemain, 2010). PCR amplification is performed, cloning and Illumina sequencing of the bacterial 16S rRNA and fungal 18S ITS performed and compared to databases hosted by NCBI to allow a benchmark for assessment of phylogeny (Cole JR, 2009). Illumina sequencing was chosen due to the low cost and sequencing quality (Gregory B. Gloor, 2010). (Wang Q, 2007) determined that longer sequences are easier to assign to taxonomic groups, in this case, reads of 300bp were determined. Illumina sequencing has two main technologies: HISEQ, which generates more reads but requires a longer time, and MISEQ which provides less reads but at a longer sequence length, reduced time and reduced cost, hence its use in this experiment. The workflow of Illumina has four basic steps; a sequencing library is produced by random fragmentation of DNA/cDNA samples, followed by ligation of 5 and 3 adapters. These adapters are amplified through polymerase chain reaction (PCR) and the gel purified. Libraries are loaded onto flow cells, binding to a lawn of surface bound oligonucleotides which are complementary to the library adapters. Each of these fragments is amplified into distinct clonal clusters by the process of bridge amplification. Single bases ar e then incorporated into DNA template strands. All the 4 reversible dNTPs are present during sequencing, natural competition reduces incorporation bias, thereby reducing error rates. Data analysis involves alignment of new identified sequence reads with a reference genome (Illumina, 2016). Predictions A previous understanding of the microbial communities to be expected on wild type Arabidopsis thaliana was vital in order to discern changes in community composition of fhy3 far1 double null mutant plants. Numerous studies have been performed to determine the microbiome of the rhizosphere and phyllosphere, mostly through the use of fingerprinting and clone libraries (Reisberg EE, 2012). Arabidopsis thaliana microbial communities have been studied at a genome wide level (Matthew W. Horton, 2014), due to potential ecological and agricultural interest particularly when it comes to micro biotic resistance. (Matthew W. Horton, 2014) determined that in wildtype Arabdopsis, the majority of OUTs are from families of Proteobacteria, Bacterioidetes and Actinobacteria. Common genera included Sphingomonas, Flavobacterium, Rhizobium and Pseudomonas. (J.M. Whipps, 2007) determined that the phylosphere was dominated by Alpharoteobacteria, Gammaproteobacteria and Bacteroidetes. Betaproteobacteria and firmicutes have also been noted to be present at high abundances. Acidobacteria, Actinobacteria and cyanobacteria have all been found in low abundances (J.M. Whipps, 2007). Fungal OUTs tend to be from Ascomycete classes Dothideomycetes and Sordariomycetes and the basidiomycete class Tremellomycets (Matthew W. Horton, 2014). A study by (Delmotte N, 2009) analysed what bacterial communities are most abundant in naturally occurring A. thaliana phyllosphere and discovered Methylobacterium, Sphingomonas and Pseudomonas to be the most prevalent. Commensals belonging to the genus Sphingomonas have been linked with protecting plants from pathogens (Innerebner G, 2011). Many of the genera are pathogenic; such as Epicoccum, Alternaria, Mycospharella, Fusarium and Plectspharella..Interestingly, a lot of these genera are seed transmitted, suggesting a reason for their permanent association with A. thaliana. Microbial communities are largely shaped around host genetics, with changes in genes relating to defence response yielding the greatest changes in microbial communities. Due to the fhy3 far1 double null mutants constitutively activated immune response, one can assume that the plant will have an enhanced resistance against pathogenic organisms. Materials and Methods Plant Material, Growth Conditions and Extraction of Phyllospheric Microbes The fhy3 far1 double null mutant line of Arabidopsis thaliana with a Nossen (No-0) ecotype was obtained from the Xing Wang Deng group at Yale university, New Haven, USA (Wang and Deng, 2002). Double mutant plant lines fhy3-4 and far1-2 were produced through 1-Methylsulfonyloxyethane (EMS)-mutagenesis by Hudson et al (1999). Plants displayed a dwarfism phenotype, necrotic lesions on their leaves and accumulation of both ROS and SA. Plants were grown in standard controlled environment chambers in white light at a Photon Flux Density of 164  µmol m-2 s-1 in short day conditions which correspond to 8 hours of light and 16 hours of darkness for 4 weeks. Plants were grown on a compost mixture consisting of 6 parts Levington M3 (Scotts, UK), 6 parts John Innes number 3 (Westland, UK), and 1 part (Sinclair, UK). Phyllospheric microbes were extracted according to the protocol from Zhou et al (1996). The above ground growing parts from at least six plants were pooled for each sample. 100 mg of above ground growing parts of WT and fhy3 far1 mutant plants, 2.7 ml of DNA extraction buffer and 10  µl of proteinase K (10 mg/ml) were added in falcon tubes. Tubes were shaken horizontally at 225rpm at RT for 30 mins. 0.3 ml of 5% SDS was added and tubes were incubated at 65 °C for 2 h with gentle mixing. The samples were centrifuged at 6,00 g for 10 min at RT and supernatants were collected. Pellets were extracted two more times after addition of 0.8 ml of extraction buffer and 20  µl of 5 % SDS. Tubes were vortexed for 10 sec, incubated at 65 °C for 10 min and centrifuged. Supernatants from all three cycles of extractions were combined and mixed with equal volumes of chloroform-isoamyl alcohol (24:1, vol/vol). The aqueous phase was recovered by centrifugation and precipitated with 0.6 volume of isopropanol at RT for 1 h. The pellet of crude nucleic acids was obtained by centrifugation at 16,000g for 20 min at RT. The pellet was washed with ice cold 70 % ethanol, dried at 37 °C and resuspended in sterile deionized water for a final volume of 500  µl. DNA extraction buffer contained 100 mM Tris-HCl (pH 8.0), 100 mM sodium EDTA (pH 8.0), 100 mM sodium phosphate (pH 8.0), 1.5 M NaCl and 1% CTAB. PCR for High-throughput Sequencing and Sequencing Analysis PCRs for bacteria and fungi rDNA-related sequences were performed in volumes of 20  µl, with 1 x GoTaq Flexi Buffer, 1.5 mM MgCl2, 200  µM dNTPs, 0.2  µM forward primer, 0.2  µM reverse primer, 1.25 units of GoTaq Flexi DNA Polymerase, 1  µl colony suspension and distilled water. To amplify bacterial 16S rDNA and reduced mitochondria- and chloroplast-specific rDNA-amplicons, two PCRs were run. PCR primer pair 63f 63f (5-CAGGCCTAACACATGCAAGTC-3) / 1492r (5-GGCTACCTTGTTACGACTT-3) used for amplification of bacterial, mitochondria and chloroplast specific rDNA amplicons. The degenerative primer 783r (5-CTACCVGGGTATCTAATCCBG-3) is a mix of nine primers (783r-a1 (CTACCAGGGTATCTAATCCTG), 783r-b1 (CTACCGGGGTATCTAATCCCG), 783r-c1 (CTACCCGGGTATCTAATCCGG), and 783r-a2 (CTACCGGGGTATCTAATCCTG), 783r-b2 (CTACCCGGGTATCTAATCCCG), 783r-c2 (CTACCAGGGTATCTAATCCGG), and 783r-a3 (CTACCCGGGTATCTAATCCTG), 783r-b3 (CTACCAGGGTATCTAATCCCG), 783r-c3 (CTACCGGGGTATCTAATCCGG)). The degenerative primer 783r was designed to reduce amplification of chloroplast 16S rDNA (Sakai et al., 2004). For amplification of fungal intergenic spacers, the primer ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) (White et al., 1990) were used. Eventually, 200 ng of DNA per sample, consisting of 100 ng DNA from bacteria-specific primer PCR and 100 ng DNA from fungi-specific primer PCR, were sent for high-throughput sequencing using the Illumina MiSeq platform to the Department of Epidemiology and Biostatistics, Institute for Computational Biology, Case Western Reserve University, Ohio, USA. Data processing Samples S13 and S15 consisted of sequences from the fhy3 far1 double null mutant whilst samples S14 and S16 belonged to the wild type Arabidopsis thaliana. A collective total of 182218 and 496243 sequences were present for fhy3 far1 and wildtype samples respectively. The first 20,000 sequences of each of the four samples were retrieved from the raw FASTQ data files using the cut feature of NextGen Sequence Workbench (Heracle BioSoft, 2016). FASTQC High Throughput Sequence QC Report v0.11.5 (Simon Andrews, 2011-15) was used to analyse sequence quality. FASTQ sequences were converted to FASTA format with FASTQ to FASTA converter from the Galaxy platform (Gordon, 2016). Sequences with a Phred quality score under 20 were trimmed using default parameters of Trim Galore! (Krueger, 2016). Paired end reads were trimmed to discard the leading 8bp barcode. VSearch was used for sample dereplication (Rognes Torbjà ¸rn, 2015). Due to the composite nature of the samples (containing both bacterial and fungal reads), a method had to be devised to separate them. SILVAngs was used to provide data analysis for 16S bacterial amplicon reads through an automatic software pipeline using the SILVA rDNA database (Quast C, 2013). SILVAngs was unable to process the 18S ITS fungal sequences. Through the SILVA output, recognised bacterial sequences were determined for each sample. Using NextGen Sequence Workbench (Heracle BioSoft, 2016), these recognised bacterial sequences could be marked as contaminants and removed from the raw FASTA sequence data files, thereby leaving the fungal reads. Basic Local Alignment Search Tool from NCBI were used on the FASTA sequences (Altschul, 1990). Parameters were altered so that only the ten most similar alignments were retrieved per sequence. A pipeline was built using python and local copies of mapping files maintained by GenBank (Dennis A. Benson, 2005): ftp://ftp.ncbi.nih.gov/pub/taxonomy/gi_taxid_nucl.dmp.gz for corresponding taxonomic IDs for GIDs and ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz for matching taxonomic ID to scientific names. The pipeline functioned by converting genbank IDs to taxonomic ID and abundance count. The taxanomic ID was then matched to scientific names and defined to a taxonomic hierarchy. Sequences with an abundance under 3 were removed as singletons. Sequences assigned to A. thaliana chloroplast 16S rRNA gene or mitochondria were removed. Statistical analysis For diversity computation, samples were rarefied to the sample with the lowest sampling effort (3390 for fungal and 4988 for bacterial). Diversity indices, richness estimators, rarefaction curves and eigenvector techniques such as principal component analysis were all performed using PAST 3.14 (Hammer, 2001). Wilcoxon Signed-Rank test was performed using IBM SPSS Statistics (IBM Corp, 2013). Heatmaps were generated using (Wahlestedt, 2016). Krona plug in was used for abundancy chats (Ondov BD, 2011) Results Statistical Analysis of Bacterial Communities Statistical analysis at a genus level indicated the following. Rarefaction curves showed a lack of sampling depth in fhy3far1. Diversity t tests determined that fhy3 far1 mutants displayed a greater diversity in comparison to wildtype A. thaliana, with a Shannon index of 3.51 and 2.85 respectively. Dominance values indicate that wild type A. thaliana contained select few genera which dominated the sample size. Simpson_1-D indicated that fhy3 far1 mutants possessed the greatest amount of sample diversity, though only marginally (0.95 and 0.91 respectively), whilst Evenness was highest in wildtype. Shannon index determined that fhy3 far1 samples had greater alpha diversity, confirmed by a Chao-1 score of 222.7, indicating greater species richness. Beta diversity was also greater in fhy3 far1. Alpha diversity indices are all displayed in table 1. Wilcoxon Signed-Rank test was performed with the null hypothesis that wild type and fhy3 far1 samples would contain similar bacterial community composition. The results indicate that the fhy3 far1 plant had 165 species with a higher abundance than in wild type A. thaliana. Test statistics indicated that fhy3 far1 contained a statistical difference in microbial abundances (P Principal component analysis at a phylum level revealed that PC 1 (98.5%) and PC2 (1.46%) were able to explain 99% of the variation. The result indicated a higher association of Baceroidetes and Acidobacteriales with fhy3 far1, separating it from the wild type which had higher correlation with Actinobacteria and Firmicutes. At a genus level (figure 2), wild type A. thaliana is correlated with Bacillales, Bacillus, Brevibacterium, Sphingomonas, Rhizobiales and Lysobacter. Genera associated with fhy3 far1 were determined to be Devosia, Advenella, Chitinophaga, Shinella, Rhizobium, Pricia and Pedobacter. Discussion Despite Arabidopsis thaliana having been studied for over 20 years in respect to the mechanisms of its immune responses (Kunkel, 1996), its not until the works of (Joel M. Kniskern, 2007) and (Matthew W. Horton, 2014) that an insight into the natural bacterial and fungal communities of A. thaliana was made. The aims of this project were to determine the commensal bacterial and fungal communities of A. thaliana and investigate the effect of the fhy3 far1 mutants constitutively activated immune response on said communities. In this study, we characterized the phyllosphere of wild type and fhy3 far1 mutant Arabidopsis thaliana using an Illumina sequencing survey of 16S rRNA and 18S ITS genes. To explain the results observed, we had to examine the effects of a constitutively activated immune response. The fhy3 far1 double null mutant has no way of negatively regulating SA signalling, this is due to the fact that FHY3 and FAR1 negatively regulate both stress and defence responsive genes, some of which are involved in the SA signalling pathway (EDS1, SID2, PAD4 and NDR1) (Wanqing Wang, 2015). This also induced the expression of a large amount of CC-NB-LRR and TIR-NB-LRR type R proteins. Many of these R genes will encode for protein homologs which mediate resistance against specific genera of bacteria and fungi. Some gene products can contain pathogen growth by indirect means; reinforcing the defensive capabilities of host cell walls and inducing stomatal closure (Jorg Durner, 1997). Alternatively, R gene products which have direct effects are usually antimicrobial metabolites (phytoalexins), papillae formation and induction of JA signalling and HR. Due to ETI being a direct tailored response to specific effectors detected by R proteins, it stands to reason that the activation of R genes will have a more profound effect on pathogenic species producing effectors. ETI commonly leads to an apoptic hypersensitive response, as observed by the necrotic lesions (Jorg Durner, 1997). As non-pathogenic species are unlikely to produce effectors (Toni J. Mohr, 2008), they wont receive an ETI response and therefore may be resistant to the immune response. Alternatively, non-pathogenic species may possess a suite of effector proteins which allow the nonpathogen to overcome some host defence systems (Grennan, 2006).The reactive oxygen species accumulation can be seen as the plants establishment of defence, strengthening host cell walls by cross linking glycoproteins, or act as executioners of pathogens by lipid peroxidation and membrane damage (Miguel Angel Torres, 2006). Alternatively, it may function as a plant signalling molecule, much in the likes of salicylic aci d. Constitutive immune activation reduces abundance of pathogenic bacteria, but not pathogenic fungi. Interestingly, we discovered that fhy3 far1 A. thaliana plants showed a decreased abundance of bacterial species associated with pathogenesis, thereby indicating that the effector triggered immunity response was effective and targeted towards pathogens. We were not able to show a specificity in plant response to non-pathogenic bacteria, as these too were affected by the ETI, seemingly without discrimination. Numerous reports indicate that the effects of plant defence processes on the microbiome are variable, with SAR being responsible for controlling the populations of some bacteria. (John W. Hein 2008) determined significant differences in rhizopshere bacterial community composition in A. thaliana mutants deficient in systemic acquired resistance (SAR), however, direct chemical activation of SAR by (Peter A.H.M. Bakker, 2013) caused little difference in community composition. (Joel M. Kniskern, 2007) analysed the effects of salicylic acid mediated defense induction, simmilarly to wh at we have tried to show in this experiment, conclusing a change in phyllospheric communities; notable a reduction in deiversity of endophytes, but higher epiphytic diversity, in concordance with our findings. We also concluded that the mutants constitutively activated immune response had no real effect on pathogenic fungi, in fact- the mutant hosted an increased abundance of pathogenic fungi. This was unusual due to the assumption that ETI would be targeted towards these species. This hints at the possibility that fungal communities are shaped by the bacterial communities present on the plant. It has been noted that SA and SAR do not contribute to resistance to necrotrophic pathogens (Joanna Ã…Â az ´niewska, 2010), however some literature contradicts our findings. Bacterial community diversity is increased in fhy3 far1 A. thaliana Our initial survey of the wild type bacterial communities of A. thaliana in samples 14 and samples 16 revealed a disparity in initial composition, however a Wilcoxon Signed Ranks test indicated no statistically significant difference between the two. 91 different morphotypes were detected and assigned to species on the basis of 16S sequence alignment. The most abundant species, Bacillales and Bacillus from the order Bacillalesare unusual in that they have not been previously described in A. thaliana. These high abundances are only from Sample 14, and were not observed in Sample 16. This may be a sequencing error or alternatively due to contamination. Bacillus have been described as mutually beneficial rhizobacterium in some plants; providing plants with growth promoting traits (Nathaniel A. Lyngwi, 2016). The Gammaproteobacteria of the genera Pseudomonas were found in a high abundance, a result which coincides with the literature (Matthew W. Horton, 2014) (J.M. Whipps, 2007). (Fumiaki Katagiri, 2002) has noted that Pseudomonas syringae is pathogenic to A. thaliana, triggering a hypersensitive response (HR) a rapid associated death of plant cells. The fhy3 far1 mutant showed a severe decrease in abundance; which could be associated to the over expression of Arabidopsis R genes: RPS2, RPM1, RPS4, RPS5 and PBS1, which mostly belong to nucleotide binding site-leucine rich repeat classes of R genes (Fumiaki Katagiri, 2002). (Wanqin