Thursday, October 31, 2019
What effect does the financial crisis have on the luxury fashion Essay - 1
What effect does the financial crisis have on the luxury fashion market - Essay Example Companies are looking forward to commence with some sort of strategies which would help them to retain their revenue and sustain in such economic turbulence. The predictions have been made that financial woes would continue for few years and will deflate consumer spending even more. (your statement) Ã The term financial crisis is largely used when the financial institutions lose a large quantity of their value. The financial crisis is allied with banking panics, stock market crashes, bursting of financial bubbles, currency crisis and sovereign defaults. The global financial calamity started in July 2007, when around the world stock markets collapsed, and the financial institutions plunged. The governments started to release some effective packages in order to save their financial systems. The investors became frightened by the abrupt decline in the stock market, which reduces their investments in the market. A luxury good is a good for which the demand of the consumer increases as the income level increases. Luxury goods have always been a symbol of prosperity and wealth for ages, for the spendthrifts, who desire and enjoy buying. Owning and wanting to be the owner of luxury items such as the latest designer clothes, jewelry, watches, is a pleasure on its own. Items that comes with a heavy price tag than ordinary items and have a known brand name is identified as luxury item. In economics, luxury goods have said to have high elasticity of demand, which means that when buyers become wealthier they would like to spend more and more cash on the luxury items. It also means that when there is a turn down in income level there will be a decrease in demand. Both income and demand are directly proportional to each other, if one increases the other rises as well and vice versa. Income elasticity of demand is not constant with respect to income, and the demand may changes at different income leve ls. That is to say, a
Monday, October 28, 2019
Iran continues to bravely slam USA and its closest ally, Israel Essay Example for Free
Iran continues to bravely slam USA and its closest ally, Israel Essay The news is about the UN decision to invite President Mahmoud Ahmadinejad of Iran to the food summit in Rome Italy. It features the reaction of Israelââ¬â¢s President Shimon Peres claiming that Ahmadinejadââ¬â¢s appearance on the summit would distract attention from problems of hunger in the world. The reaction of President Perez stemmed from the statement of Iranian President that Israel was ââ¬Å"doomed to go. â⬠The news also quoted the statement of Rafsanjani, another top official of Iran stating that Iran and other Muslim nations must stop the USA from enslaving Iraqis. Rafsanjani commented that the US-led occupation of Iraq represents a danger to all nations of the region. He said that Washington and Baghdad try to put Iraq under their spell through a long-term security agreement but Rafsanjani contends that the essence of this agreement ââ¬Å"is to turn Iraqis into slave before the Americans, if it is sealedâ⬠Rafsanjani stated that the Iraqi people and the Islamic nation will not allow it. â⬠Both Ahmadinijad and Rafsanjani have been featured in many internet articles as loyal to Islamic fundamentalist cause. In fact, one those articles even went on to say that Ahmadinijad is a ââ¬Å"self proclaimed religious fundamentalist. My opinion about the news is that Iran is simply attracting Islamic countries to rally behind their anti-Semitic stand. It is apparent that Islamic fundamentalist are deeply anti Semitic and are against the west not only in their export of western culture and western style democracy, but because the West are obviously supporting Israel. Ahmadinejad is taking advantage of every opportunity to express their views on US Israeli affairs before an international gathering obviously for its own propaganda designed to draw sympathy against the US. While it may be true that the US may its own interest in maintaining its presence in Iraq, but I would say that Mr. Rafsanjani statement is out of bounds intended only to make matters worse for the US, before the international audience. Iran probably has an axe to grind against the US because of its support to Iraq during Iran Iraq war. Arabs and Islamic Fundamentalist opinion has flamed against the United States because of its unwavering support to Israel who has dispossessed the Palestinians of their settlement in Jerusalem. Iranââ¬â¢s hatred of Israel is deeply enshrined in their nationalism and cultural emphasis. The statement therefore voiced by two of the highest Iranian officials is not based on objective criticism but is only a political ideology. Concerning the feeling of anti- Semitism, Iran is not alone in their hatred to Israel, as earlier century have seen the expulsion of the Jews in some countries like Spain and England, two of the many countries who expelled the Jews. All of those expulsion happened long before the Israeli- Palestinian conflict had started. However, Mr. Ahmadinejad must learn to recognize the danger of provoking the remaining super power to turn its back against Iran. Iran must look at the case of Iraq and try to figure out the worst-case scenario. Today, many countries are working very hard in the concept of globalization, and high technology equipment. These countries are today the fastest growing economies. For Iran to cache up with these developments, Iran should better stop thinking of annihilating the Jews, but start working cooperatively and mutually with every country particularly Israel and the United States.
Saturday, October 26, 2019
Immune System of a Plant
Immune System of a Plant ABSTRACT Two light signalling factors, FAR-RED ELONGATED HYPOCOTYL3 (FHY3) and FAR-RED IMPAIRED RESPONSE 1 (FAR1) regulate chlorophyll biosynthesis, seedling growth and modulate plant immunity by controlling HEMB1 expression in Arabiopsis thaliana. We show that fhy3 far1 double null mutants display high levels of reactive oxygen species, salicylic acid and high expression of pathogen related genes. We analyse the effects of this constitutively activated immune response on commensal microbial communities through use of a next generation sequencing based approach. We determine that fhy3 far1 mutants contain greater species diversity and a greater resistance against pathogenic bacteria. Fungal pathogens increase in abundance in fhy3 far1 mutants. Taken together, this study demonstrates the important role of FHY3 and FAR1 in commensal microbial community composition as well as the importance of bacterial fungal relations. INTRODUCTION The Microbiome Microorganisms are an extremely diverse group of organisms; making up an astonishing 60% of the Earths total biomass (Singh, 2009). Soil sustains as many as 4-51030 microbial cells (Singh, 2009), all contributing to soil structure formation, decomposition, and recycling of organic matter into its constituent elements and nutrients. Microorganisms present in the soil adjacent to plant roots are part of the Rhizosphere. (Garbeva, 2004) highlights their pivotal roles in the suppression of plant disease (Badri DV, 2009), promotion of plant growth (Lugtenberg, 2009), development and health (Mendes, 2011). Leaves usually dominate the aerial part of the plant, representing of the most significant terrestrial habitats for microorganisms: the Phyllosphere (Vorholt JA, 2012). A diverse community of bacteria and fungi inhabit this challenging habitat; with nutrient deficiency and fluctuations in temperature, humidity and UV radiation (Lindow SE, 2003). The microbial communities here are shaped by biotic factors: (Yang CH, 2001) states that species, genotype (van Overbeek L, 2008) and age of plant (Redford AJ, 2009) all have their respective impacts. Abiotic factors also have a profound influence over the communities present within the phyllosphere. Plant location and growth conditions such as soil composition and climate can also have a strong impact due to the physiochemical alterations they impart. (JH, 1999) also notes how plant genotype and phenotype has an impact on community assembly. Although the majority of communities exist on the plant surface, and are therefore epiphytic some exist within the plant as endophytes. Species present within the phyllosphere tend to assimilate plant derived ammonium, simple carbohydrates and amino acids, which are their primary nitrogen and carbon sources (Thomas R Turner, 2013). Microorganisms energy metabolism isnt entirely dependent on the plant; some species contain rhodopsins. Due to the abundance of processes which play a role in community composition (Weiher E, 2011), phyla with the best adaptations for survival and reproduction tend to predominate communities. These microorganisms can promote plant growth through the production of hormones, or protect plants from pathogenic organisms by producing antibiotic compounds, competing for resources (Berg G, 2009) or induction of systemic resistance (Conrath U, 2006). The use of Arabidopsis thaliana as a model organism has been vital for these studies (Innerebner G, 2011). A. thaliana is an annual forb, occurring at temperate regions worldwide in a diverse range of habitats (Elena Garcà a, 2013) In order to analyse microbial communities; a few terms need to be defined. Biodiversity is defined as the range of significantly different types of organisms and their respective relative abundance within a community, encompassing three main levels; genetic variation between species, number of respective species and community or ecological diversity (Harpole, 2010). Two main components make up species diversity: the total number of species present (species richness) and the distribution of individuals amongst said species (evenness). Operational taxonomic units (OTU) or communities provide information on an ecosystem (Mannan, 2013). Species diversity relates to the stability of a community; well organized communities tend to have the greatest stability (Yannarell, 2005). Stresses can cause disturbances in a homeostatic community, thereby disrupting it and leading to changes in species abundances. When characterizing an ecosystem such as A. thaliana, one must determine three things: T he type of microorganisms present, their roles and how these roles relate to the ecosystems function (Sani, 2011). Plant Immune Response The immune system of a plant has a selective effect upon its microbiome. Upon pathogen encounter, a plant will elicit an immune response with the goal of limiting pathogen growth. Biotrophic and hemibiotrophic pathogens (those who obtain nutrients from living host tissue) are repelled by Salicylic acid dependent defence responses. Necrotrophic pathogens (which kill their host to obtain nutrients) are sensitive to Jasmonic acid (JA) and Ethylene (ET) dependent defence responses (Christine Vogel, 2016). Plants lack specialised immune cells; therefore, their cells must have an ability to sense pathogens and mount an appropriate immune response. Pathogens are detected by pattern recognition receptors (PRRs) which bind to the microbe or pathogen associated molecular patterns (MAMP/PAMP), thereby issuing a layer of basal defence known as PAMP triggered immunity (PTI) to prevent pathogen colonization (Chuanfu An, 2011). In order for pathogens to cause disease, they must inject effectors int o plant cells, thereby interfering with PRR complexes or downstream signalling to overcome the PTI. Plants have evolved resistance proteins which recognise effectors directly or indirectly and induce effector triggered immunity (ETI). This response is far more specific, and is often followed by a hypersensitive response (HR). R proteins, mostly leucine-rich repeat (LRR) domain containing proteins and Nucleotide-binding (NB) proteins are the intracellular receptors which sense pathogen derived molecules (Heidrich K, 2012). Figure 1 shows a summary of these processes. When these proteins are activated, production of salicylic acid occurs. Salicylic acid (SA) is a phenolic phytochrome present in plants. SA holds roles in growth, development, transpiration, photosynthesis and the uptake of ions. Its also vital for the process of endogenous signalling, mediating plant defence against pathogens. Activation of defence signalling pathways causes the generation of mobile signals from the infected tissue, where they can spread to distal tissue. Here they can upregulate expression of pathogenesis related genes and induce systematic acquired resistance (SAR), a long-lasting immunity against a broad spectrum of pathogens. Sali cylic acid mediated immune responses are important factors of both PTI and ETI, essential for the activation of SAR. NB-LRR mediated disease resistance may only be effective against pathogens grown on living host tissue such as obligate or hemibiotrophic pathogens, but not against nectrotrophs (Dangl, 2006). Downstream of the NB-LRR R proteins, the pathways ENHANCED DISEASE SUSCEPTIILITY1 (EDS1) and its partner PHYTOALEXIN DEFICIENT 4 (PAD4) act in basal resistance and ETI initiated by Toll-like/Interleukin 1 receptor (TIR) type NB-LRR R proteins (Vlot AC, 2009). Both PAD4 and EDS1 amplify SA signalling through a positive feedback loop (Wanqing Wang, 2015). Coiled-coil (CC) type NB-LRR proteins are regulated by NONSPECIFIC DISEASE RESISTANCE 1. When SA levels increase as a result of pathogen challenge, redox changes are induced which cause reduction of NON EXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) to a monomeric form which activates defence responsive gene expression by accumulating within the nucleus. This results in plant immunity (Fu ZQ, 2013). Most bacteria which colonize A. thaliana are not pathogenic however still produce MAMPs. It is currently not known how plants are able to tell apart pathogenic and commensal microorganisms, and whether the recognition of these non-pathogenic phyllosphere bacteria triggers plant immune signalling networks downstream of PTI or ETI activation, with knock on effects on community structure. (Christine Vogel, 2016) determined that in response to some non pathogenic species, the detection of MAMPS leads to no change in gene expression. Note that some species of bacteria can induce transcriptional changes to protect the plants from infections of other species (Judith E. van de Mortel, 2012). FHY3 FAR1 Plants have developed regulatory mechanisms in order to cope with adverse abiotic and biotic conditions (Bray EA, 2000), however these are a detriment to their growth and development. These regulatory mechanisms activate immune responses and resistance pathways in the case of biotic stress. Constitutive activation of plant immunity would lead to impaired growth and fitness, so in the absence of stress, the immune response must revert the massive transcriptional reprograming, requiring tight genetic control (Tian D, 2003). Arabidopsis thaliana has to adapt to changes of environmental stimuli, such as light signals or temperature. Light duration, direction, wavelength, and quantity are determined by a battery photoreceptors which monitor incident red (R, 600-700 nm) and far red (FR, 700-750 nm) light wavelengths. This is achieved by switching between R absorbing and FR absorbing modes through biologically inactive Pr and active Pfr forms (PH, 2002). Photo activation of the primary photoreceptor for FR light phyA, causes translocation from the cytoplasm to the nucleus. This translocation allows induction of FR-responsive gene expression required for various photoreceptors. Two pairs of homologous genes are essential for the phyA signalling; FAR1 (far-red-impaired response 1) and FHY3 (far-red elongated hypocotyl 3). (Hudson, 2003) determined that these genes encode mutator like transposase derived transcription factors which directly bind to the promotor region HEMB1, which itself encodes a 5-1minolevuli nic acid dehydratase, ALAD) and activates its expression, thereby regulating both chlorophyll biosynthesis and seedling growth (Tang W, 2012). These regulators small plant specific proteins, which are necessary for the nuclear accumulation of light activated phyA. (Wanqing Wang, 2015) determined that fhy3 far1 double null mutants display an autoimmune response; accumulating SA and ROS, inducing PR genes and having an increased resistance to pathogen infection. They all displayed a dwarf phenotype, with necrotic lesions developing on their leaves as a result of premature cell death. Wang and his colleagues determined that FHY3 and FAR1 may act as defence-responsive gene repressors; mutants had high abundances of R genes and upregulated levels of PR genes, hinting at a possible link with regulation of NB-LRR mediated SA signalling pathways. Fhy3 far1 mutants increased expression levels of EDS1, PAD4, SID2 and EDS5 all genes involved in SA pathways. Reduction of HEMB1 in fhy3 far1 lead to a constitutively activated immune response, inducing system acquired resistance. (Wang Q, 2007) hypothesized that FHY3 and FAR1 may negatively regulate SA signalling and plant immunity through regulation of HEMB1 expression providing a possible linkage between light signalling and plant immunity. Next Generation Sequencing Most microbial communities present within nature are yet to be cultured within a laboratory; thereby leaving biomolecules such as nucleic acids, proteins, and lipids as our only source of information. For phylogenetic studies, surveys of the small ribosomal subunits (SSUs) for bacteria and the internal transcribed spacer (ITS) region of fungi are vital. Ribosomal genes are present in all organisms and contain regions which evolve slowly, coupled with faster evolving regions which permit fine tuning of taxonomic levels, to either family or genera. Note, that there also exists numerous databases for reference sequences and their respective taxonomies, such as SILVA (Pruesse, 2007) and the Ribosomal Database Project. This technique uses multiple primer pairs for each of the marker genes, each associated with its own taxon (William Walters, 2015). SSU rRNA genes are the standard reference sequence for taxonomic classification; calculating similarity between rRNAs. ITS regions are primari ly sequenced for fungi due to the higher degree of variation they display as a result of low evolutionary pressure, and clear resolution below genus level (Bellemain, 2010). PCR amplification is performed, cloning and Illumina sequencing of the bacterial 16S rRNA and fungal 18S ITS performed and compared to databases hosted by NCBI to allow a benchmark for assessment of phylogeny (Cole JR, 2009). Illumina sequencing was chosen due to the low cost and sequencing quality (Gregory B. Gloor, 2010). (Wang Q, 2007) determined that longer sequences are easier to assign to taxonomic groups, in this case, reads of 300bp were determined. Illumina sequencing has two main technologies: HISEQ, which generates more reads but requires a longer time, and MISEQ which provides less reads but at a longer sequence length, reduced time and reduced cost, hence its use in this experiment. The workflow of Illumina has four basic steps; a sequencing library is produced by random fragmentation of DNA/cDNA samples, followed by ligation of 5 and 3 adapters. These adapters are amplified through polymerase chain reaction (PCR) and the gel purified. Libraries are loaded onto flow cells, binding to a lawn of surface bound oligonucleotides which are complementary to the library adapters. Each of these fragments is amplified into distinct clonal clusters by the process of bridge amplification. Single bases ar e then incorporated into DNA template strands. All the 4 reversible dNTPs are present during sequencing, natural competition reduces incorporation bias, thereby reducing error rates. Data analysis involves alignment of new identified sequence reads with a reference genome (Illumina, 2016). Predictions A previous understanding of the microbial communities to be expected on wild type Arabidopsis thaliana was vital in order to discern changes in community composition of fhy3 far1 double null mutant plants. Numerous studies have been performed to determine the microbiome of the rhizosphere and phyllosphere, mostly through the use of fingerprinting and clone libraries (Reisberg EE, 2012). Arabidopsis thaliana microbial communities have been studied at a genome wide level (Matthew W. Horton, 2014), due to potential ecological and agricultural interest particularly when it comes to micro biotic resistance. (Matthew W. Horton, 2014) determined that in wildtype Arabdopsis, the majority of OUTs are from families of Proteobacteria, Bacterioidetes and Actinobacteria. Common genera included Sphingomonas, Flavobacterium, Rhizobium and Pseudomonas. (J.M. Whipps, 2007) determined that the phylosphere was dominated by Alpharoteobacteria, Gammaproteobacteria and Bacteroidetes. Betaproteobacteria and firmicutes have also been noted to be present at high abundances. Acidobacteria, Actinobacteria and cyanobacteria have all been found in low abundances (J.M. Whipps, 2007). Fungal OUTs tend to be from Ascomycete classes Dothideomycetes and Sordariomycetes and the basidiomycete class Tremellomycets (Matthew W. Horton, 2014). A study by (Delmotte N, 2009) analysed what bacterial communities are most abundant in naturally occurring A. thaliana phyllosphere and discovered Methylobacterium, Sphingomonas and Pseudomonas to be the most prevalent. Commensals belonging to the genus Sphingomonas have been linked with protecting plants from pathogens (Innerebner G, 2011). Many of the genera are pathogenic; such as Epicoccum, Alternaria, Mycospharella, Fusarium and Plectspharella..Interestingly, a lot of these genera are seed transmitted, suggesting a reason for their permanent association with A. thaliana. Microbial communities are largely shaped around host genetics, with changes in genes relating to defence response yielding the greatest changes in microbial communities. Due to the fhy3 far1 double null mutants constitutively activated immune response, one can assume that the plant will have an enhanced resistance against pathogenic organisms. Materials and Methods Plant Material, Growth Conditions and Extraction of Phyllospheric Microbes The fhy3 far1 double null mutant line of Arabidopsis thaliana with a Nossen (No-0) ecotype was obtained from the Xing Wang Deng group at Yale university, New Haven, USA (Wang and Deng, 2002). Double mutant plant lines fhy3-4 and far1-2 were produced through 1-Methylsulfonyloxyethane (EMS)-mutagenesis by Hudson et al (1999). Plants displayed a dwarfism phenotype, necrotic lesions on their leaves and accumulation of both ROS and SA. Plants were grown in standard controlled environment chambers in white light at a Photon Flux Density of 164 à µmol m-2 s-1 in short day conditions which correspond to 8 hours of light and 16 hours of darkness for 4 weeks. Plants were grown on a compost mixture consisting of 6 parts Levington M3 (Scotts, UK), 6 parts John Innes number 3 (Westland, UK), and 1 part (Sinclair, UK). Phyllospheric microbes were extracted according to the protocol from Zhou et al (1996). The above ground growing parts from at least six plants were pooled for each sample. 100 mg of above ground growing parts of WT and fhy3 far1 mutant plants, 2.7 ml of DNA extraction buffer and 10 à µl of proteinase K (10 mg/ml) were added in falcon tubes. Tubes were shaken horizontally at 225rpm at RT for 30 mins. 0.3 ml of 5% SDS was added and tubes were incubated at 65à °C for 2 h with gentle mixing. The samples were centrifuged at 6,00 g for 10 min at RT and supernatants were collected. Pellets were extracted two more times after addition of 0.8 ml of extraction buffer and 20 à µl of 5 % SDS. Tubes were vortexed for 10 sec, incubated at 65à °C for 10 min and centrifuged. Supernatants from all three cycles of extractions were combined and mixed with equal volumes of chloroform-isoamyl alcohol (24:1, vol/vol). The aqueous phase was recovered by centrifugation and precipitated with 0.6 volume of isopropanol at RT for 1 h. The pellet of crude nucleic acids was obtained by centrifugation at 16,000g for 20 min at RT. The pellet was washed with ice cold 70 % ethanol, dried at 37à °C and resuspended in sterile deionized water for a final volume of 500 à µl. DNA extraction buffer contained 100 mM Tris-HCl (pH 8.0), 100 mM sodium EDTA (pH 8.0), 100 mM sodium phosphate (pH 8.0), 1.5 M NaCl and 1% CTAB. PCR for High-throughput Sequencing and Sequencing Analysis PCRs for bacteria and fungi rDNA-related sequences were performed in volumes of 20 à µl, with 1 x GoTaq Flexi Buffer, 1.5 mM MgCl2, 200 à µM dNTPs, 0.2 à µM forward primer, 0.2 à µM reverse primer, 1.25 units of GoTaq Flexi DNA Polymerase, 1 à µl colony suspension and distilled water. To amplify bacterial 16S rDNA and reduced mitochondria- and chloroplast-specific rDNA-amplicons, two PCRs were run. PCR primer pair 63f 63f (5-CAGGCCTAACACATGCAAGTC-3) / 1492r (5-GGCTACCTTGTTACGACTT-3) used for amplification of bacterial, mitochondria and chloroplast specific rDNA amplicons. The degenerative primer 783r (5-CTACCVGGGTATCTAATCCBG-3) is a mix of nine primers (783r-a1 (CTACCAGGGTATCTAATCCTG), 783r-b1 (CTACCGGGGTATCTAATCCCG), 783r-c1 (CTACCCGGGTATCTAATCCGG), and 783r-a2 (CTACCGGGGTATCTAATCCTG), 783r-b2 (CTACCCGGGTATCTAATCCCG), 783r-c2 (CTACCAGGGTATCTAATCCGG), and 783r-a3 (CTACCCGGGTATCTAATCCTG), 783r-b3 (CTACCAGGGTATCTAATCCCG), 783r-c3 (CTACCGGGGTATCTAATCCGG)). The degenerative primer 783r was designed to reduce amplification of chloroplast 16S rDNA (Sakai et al., 2004). For amplification of fungal intergenic spacers, the primer ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) (White et al., 1990) were used. Eventually, 200 ng of DNA per sample, consisting of 100 ng DNA from bacteria-specific primer PCR and 100 ng DNA from fungi-specific primer PCR, were sent for high-throughput sequencing using the Illumina MiSeq platform to the Department of Epidemiology and Biostatistics, Institute for Computational Biology, Case Western Reserve University, Ohio, USA. Data processing Samples S13 and S15 consisted of sequences from the fhy3 far1 double null mutant whilst samples S14 and S16 belonged to the wild type Arabidopsis thaliana. A collective total of 182218 and 496243 sequences were present for fhy3 far1 and wildtype samples respectively. The first 20,000 sequences of each of the four samples were retrieved from the raw FASTQ data files using the cut feature of NextGen Sequence Workbench (Heracle BioSoft, 2016). FASTQC High Throughput Sequence QC Report v0.11.5 (Simon Andrews, 2011-15) was used to analyse sequence quality. FASTQ sequences were converted to FASTA format with FASTQ to FASTA converter from the Galaxy platform (Gordon, 2016). Sequences with a Phred quality score under 20 were trimmed using default parameters of Trim Galore! (Krueger, 2016). Paired end reads were trimmed to discard the leading 8bp barcode. VSearch was used for sample dereplication (Rognes Torbjà ¸rn, 2015). Due to the composite nature of the samples (containing both bacterial and fungal reads), a method had to be devised to separate them. SILVAngs was used to provide data analysis for 16S bacterial amplicon reads through an automatic software pipeline using the SILVA rDNA database (Quast C, 2013). SILVAngs was unable to process the 18S ITS fungal sequences. Through the SILVA output, recognised bacterial sequences were determined for each sample. Using NextGen Sequence Workbench (Heracle BioSoft, 2016), these recognised bacterial sequences could be marked as contaminants and removed from the raw FASTA sequence data files, thereby leaving the fungal reads. Basic Local Alignment Search Tool from NCBI were used on the FASTA sequences (Altschul, 1990). Parameters were altered so that only the ten most similar alignments were retrieved per sequence. A pipeline was built using python and local copies of mapping files maintained by GenBank (Dennis A. Benson, 2005): ftp://ftp.ncbi.nih.gov/pub/taxonomy/gi_taxid_nucl.dmp.gz for corresponding taxonomic IDs for GIDs and ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz for matching taxonomic ID to scientific names. The pipeline functioned by converting genbank IDs to taxonomic ID and abundance count. The taxanomic ID was then matched to scientific names and defined to a taxonomic hierarchy. Sequences with an abundance under 3 were removed as singletons. Sequences assigned to A. thaliana chloroplast 16S rRNA gene or mitochondria were removed. Statistical analysis For diversity computation, samples were rarefied to the sample with the lowest sampling effort (3390 for fungal and 4988 for bacterial). Diversity indices, richness estimators, rarefaction curves and eigenvector techniques such as principal component analysis were all performed using PAST 3.14 (Hammer, 2001). Wilcoxon Signed-Rank test was performed using IBM SPSS Statistics (IBM Corp, 2013). Heatmaps were generated using (Wahlestedt, 2016). Krona plug in was used for abundancy chats (Ondov BD, 2011) Results Statistical Analysis of Bacterial Communities Statistical analysis at a genus level indicated the following. Rarefaction curves showed a lack of sampling depth in fhy3far1. Diversity t tests determined that fhy3 far1 mutants displayed a greater diversity in comparison to wildtype A. thaliana, with a Shannon index of 3.51 and 2.85 respectively. Dominance values indicate that wild type A. thaliana contained select few genera which dominated the sample size. Simpson_1-D indicated that fhy3 far1 mutants possessed the greatest amount of sample diversity, though only marginally (0.95 and 0.91 respectively), whilst Evenness was highest in wildtype. Shannon index determined that fhy3 far1 samples had greater alpha diversity, confirmed by a Chao-1 score of 222.7, indicating greater species richness. Beta diversity was also greater in fhy3 far1. Alpha diversity indices are all displayed in table 1. Wilcoxon Signed-Rank test was performed with the null hypothesis that wild type and fhy3 far1 samples would contain similar bacterial community composition. The results indicate that the fhy3 far1 plant had 165 species with a higher abundance than in wild type A. thaliana. Test statistics indicated that fhy3 far1 contained a statistical difference in microbial abundances (P Principal component analysis at a phylum level revealed that PC 1 (98.5%) and PC2 (1.46%) were able to explain 99% of the variation. The result indicated a higher association of Baceroidetes and Acidobacteriales with fhy3 far1, separating it from the wild type which had higher correlation with Actinobacteria and Firmicutes. At a genus level (figure 2), wild type A. thaliana is correlated with Bacillales, Bacillus, Brevibacterium, Sphingomonas, Rhizobiales and Lysobacter. Genera associated with fhy3 far1 were determined to be Devosia, Advenella, Chitinophaga, Shinella, Rhizobium, Pricia and Pedobacter. Discussion Despite Arabidopsis thaliana having been studied for over 20 years in respect to the mechanisms of its immune responses (Kunkel, 1996), its not until the works of (Joel M. Kniskern, 2007) and (Matthew W. Horton, 2014) that an insight into the natural bacterial and fungal communities of A. thaliana was made. The aims of this project were to determine the commensal bacterial and fungal communities of A. thaliana and investigate the effect of the fhy3 far1 mutants constitutively activated immune response on said communities. In this study, we characterized the phyllosphere of wild type and fhy3 far1 mutant Arabidopsis thaliana using an Illumina sequencing survey of 16S rRNA and 18S ITS genes. To explain the results observed, we had to examine the effects of a constitutively activated immune response. The fhy3 far1 double null mutant has no way of negatively regulating SA signalling, this is due to the fact that FHY3 and FAR1 negatively regulate both stress and defence responsive genes, some of which are involved in the SA signalling pathway (EDS1, SID2, PAD4 and NDR1) (Wanqing Wang, 2015). This also induced the expression of a large amount of CC-NB-LRR and TIR-NB-LRR type R proteins. Many of these R genes will encode for protein homologs which mediate resistance against specific genera of bacteria and fungi. Some gene products can contain pathogen growth by indirect means; reinforcing the defensive capabilities of host cell walls and inducing stomatal closure (Jorg Durner, 1997). Alternatively, R gene products which have direct effects are usually antimicrobial metabolites (phytoalexins), papillae formation and induction of JA signalling and HR. Due to ETI being a direct tailored response to specific effectors detected by R proteins, it stands to reason that the activation of R genes will have a more profound effect on pathogenic species producing effectors. ETI commonly leads to an apoptic hypersensitive response, as observed by the necrotic lesions (Jorg Durner, 1997). As non-pathogenic species are unlikely to produce effectors (Toni J. Mohr, 2008), they wont receive an ETI response and therefore may be resistant to the immune response. Alternatively, non-pathogenic species may possess a suite of effector proteins which allow the nonpathogen to overcome some host defence systems (Grennan, 2006).The reactive oxygen species accumulation can be seen as the plants establishment of defence, strengthening host cell walls by cross linking glycoproteins, or act as executioners of pathogens by lipid peroxidation and membrane damage (Miguel Angel Torres, 2006). Alternatively, it may function as a plant signalling molecule, much in the likes of salicylic aci d. Constitutive immune activation reduces abundance of pathogenic bacteria, but not pathogenic fungi. Interestingly, we discovered that fhy3 far1 A. thaliana plants showed a decreased abundance of bacterial species associated with pathogenesis, thereby indicating that the effector triggered immunity response was effective and targeted towards pathogens. We were not able to show a specificity in plant response to non-pathogenic bacteria, as these too were affected by the ETI, seemingly without discrimination. Numerous reports indicate that the effects of plant defence processes on the microbiome are variable, with SAR being responsible for controlling the populations of some bacteria. (John W. Hein 2008) determined significant differences in rhizopshere bacterial community composition in A. thaliana mutants deficient in systemic acquired resistance (SAR), however, direct chemical activation of SAR by (Peter A.H.M. Bakker, 2013) caused little difference in community composition. (Joel M. Kniskern, 2007) analysed the effects of salicylic acid mediated defense induction, simmilarly to wh at we have tried to show in this experiment, conclusing a change in phyllospheric communities; notable a reduction in deiversity of endophytes, but higher epiphytic diversity, in concordance with our findings. We also concluded that the mutants constitutively activated immune response had no real effect on pathogenic fungi, in fact- the mutant hosted an increased abundance of pathogenic fungi. This was unusual due to the assumption that ETI would be targeted towards these species. This hints at the possibility that fungal communities are shaped by the bacterial communities present on the plant. It has been noted that SA and SAR do not contribute to resistance to necrotrophic pathogens (Joanna Ãâ¦Ã azà ´niewska, 2010), however some literature contradicts our findings. Bacterial community diversity is increased in fhy3 far1 A. thaliana Our initial survey of the wild type bacterial communities of A. thaliana in samples 14 and samples 16 revealed a disparity in initial composition, however a Wilcoxon Signed Ranks test indicated no statistically significant difference between the two. 91 different morphotypes were detected and assigned to species on the basis of 16S sequence alignment. The most abundant species, Bacillales and Bacillus from the order Bacillalesare unusual in that they have not been previously described in A. thaliana. These high abundances are only from Sample 14, and were not observed in Sample 16. This may be a sequencing error or alternatively due to contamination. Bacillus have been described as mutually beneficial rhizobacterium in some plants; providing plants with growth promoting traits (Nathaniel A. Lyngwi, 2016). The Gammaproteobacteria of the genera Pseudomonas were found in a high abundance, a result which coincides with the literature (Matthew W. Horton, 2014) (J.M. Whipps, 2007). (Fumiaki Katagiri, 2002) has noted that Pseudomonas syringae is pathogenic to A. thaliana, triggering a hypersensitive response (HR) a rapid associated death of plant cells. The fhy3 far1 mutant showed a severe decrease in abundance; which could be associated to the over expression of Arabidopsis R genes: RPS2, RPM1, RPS4, RPS5 and PBS1, which mostly belong to nucleotide binding site-leucine rich repeat classes of R genes (Fumiaki Katagiri, 2002). (Wanqin
Thursday, October 24, 2019
Essay --
A true friend is someone you can confide in without fear of being judged or betrayed... It is always good to have a friend in whom you can confide. A true friend is a good listener ââ¬â one with whom you can share your thoughts and feelings without worrying whether they will judge you or tell other people about you. You should be able to trust a friend, particularly when you are in need of someone to share your problems with..... In ââ¬Å"The Boy in the Striped Pyjamasâ⬠by John Boyne, Bruno, the main character is in need of a good friend. He is unhappy, having being forced to move away from his home in Berlin and ââ¬Ëhis three best friends for lifeââ¬â¢ because his father has a new job. Bruno, his mother and sister accompany the new commandant to the new house at ââ¬Å"Out-With,â⬠as Bruno calls it. This new house is small, dark, and strange. Bruno spends long days gazing out the window of his new bedroom, where he notices people dressed in striped pyjamas and rows of barracks surrounded by a barbed wire fence. With nobody except his sister ââ¬ËThe Hopeless Caseââ¬â¢ to talk to, bored and lonely, and not really understanding the circumstance of his new existence, Bruno sets out to explore the area, despite being forbidden to do so by his parents. He discovers Shmuel, a very thin Jewish boy who lives on the other side of the fence and an unlikely friendship between the two boys is form ed. Over the next few months the two children swap life stories through the wire fence. Shmuel explains how he and his family have been transported here from a ghetto in Poland. Unable to comprehend the gravity of Shmuelââ¬â¢s situation, Bruno is simply content to have found a playmate. In particular he finds it amazing that they are the same age and born on exactly th... ...d hegathers himself and makes a clear decision to face his fear in order to help his friend.... Even when the two boys have been herded into the gas chambers about to face their death, Bruno stands by his friend, holding Shmuelââ¬â¢s hand, forgetting even the names of his friends in Berlin and saying that Shmuel is one true friend for life. To conclude, Bruno and Shmuelââ¬â¢s friendship is both strange and genuine. Bruno confides in Shmuel, at first, because he is lonely and innocent. However as the novel develops their friendship grows into something authentic which crosses the boundaries of race, religion and culture. Over the course of the novel there are times when the friendship is tested, threatened and almost betrayed but Bruno and Shmuel remain true to their friendship even in the darkest and devastating of endings...At the end they died together...
Wednesday, October 23, 2019
Marquis M. Converse
Marquis M. Converse is an entrepreneur, founder of Converse. About Converse Converse origins of the company date back to 1908 when Marquis M. Converse opened the factory in Massachusetts called Converse Rubber Shoe Company. The factory initially produced only rubber soles for all types of footwear since 1915, however, focused on the production of tennis shoes from her and moved smoothly to produce shoes for basketball. And here starts writing legend. Year 1917, the year he saw the light of day Converse All-Star.Unbelievably innovator shoes that brought in, at that time, a relatively young sport ââ¬â basketball, lots of new features and ideas. , four years later, the company made a brilliant move Converse, employs basketball player Chuck Taylor All-Star who wore as her favorite shoes. In addition, players is becoming a trader company Converse and brand design. On all models Converse ââ¬â Chuck Taylor All-Stars appears his signature sneakers ever confirms a legend. Connection and Converse Chuck Taylor sneakers in the world became indivisible.Converse as one of the first manufacturers in the world and sneakers Chuck Taylor as a basketball superstar of his time. Present Converse Conversky most famous are forever All-Stars, but the list of models of this brand does not end. Became less popular as basketball shoes from 1986 that bear the name The Weapon. The model also underwent Weapon reissue, the first in 2002, when they came to the ceremony itself Teen Choice Awards Kobe Bryant and the other in 2003 under the name The Loaded Weapon. All models from Converse is produced for years in a wide variety of colors and finishes.Converse was one of the first trainers in the world and certainly will not be the last. At least take care of it, Nike, Converse brand that already own some that Friday. Chuck Taylor All Star ââ¬â (also known as ââ¬Å"Chucksâ⬠, ââ¬Å"Consâ⬠, ââ¬Å"Coniesâ⬠) are shoes of 20 century that it all began. The original canvas and rubber boots classic Chuck Taylor All Star is the idol of America, which has sold over 750 million pairs in 144 countries Converse Sports Lifestyle ââ¬â footwear is designed to be worn on the street, in clubs and schools.The different shapes are inspired by the urban youth skate shoes and white leather shoes that are clear leaders in the field of urban fashion. Inextricably linked with the history and heritage of Converse shoes are developed for life outside playground and playing field. Converse One Star ââ¬â are popular with skateboarding and surfing community as retro, alternative lifestyle that represents originality and individuality.One Star shoes, created in 1970, triggered the era of wearing shoes for all styles of so-called ââ¬Å"Indiaâ⬠athletes, individuals whose lifestyle and sport go hand in hand with creativity, imagination and sebevyjadrenim. Converse Performance Basketball ââ¬â a new class of footwear was designed to play on the playground and in the halls with an emphasis on comfort, protection and style. With the same simple and characteristics as their predecessors have shoes Converse features a new generation of advanced technology, functional design and original style which allows players to peak performance and presentation skills.
Tuesday, October 22, 2019
Literary works describing the struggle against slavery essayEssay Writing Service
Literary works describing the struggle against slavery essayEssay Writing Service Literary works describing the struggle against slavery essay Literary works describing the struggle against slavery essayThere are many literary works that are no longer explicitly organized around the struggle to end slavery. Nevertheless, it is possible to identify the main theme unifying these more contemporary fictions. Three texts that will be discussed in this paper are James Weldon Johnsonââ¬â¢s Autobiography of an Ex-Colored Man, George Schuylerââ¬â¢s Black No More and Octavia Butlerââ¬â¢s Kindred. These literary works describe the major conflicts of African American history that refer to the struggle against slavery. The authors of these novels provide the slave narratives that highlight the sentimental ideas regarding the struggle against racism. It is necessary to recognize the authorsââ¬â¢ need to identify historical impact of contemporary literature on the representation of race relations. The literary works reflect the negative effects of the Jim Crow Era on African Americans, placing emphasis on the ability of litera ture to address racial violence and ââ¬Å"see race through the lens of otherhoodâ⬠(Lavender 63). Thesis statement: Three literary works, James Weldon Johnsonââ¬â¢s Autobiography of an Ex-Colored Man, George Schuylerââ¬â¢s Black No More and Octavia Butlerââ¬â¢s Kindred, are focused on representation of the complexity of race relations which affect the further struggle to end slavery in American society.In the novel Autobiography of an Ex-Colored Man (1912) written by James Weldon Johnson, the key theme is criticism of race relations. The author of the slave narrative discussed the role of human identity in solving the problems caused by both interracial and intra-racial conflicts and violence. The novel tells about the life of a young biracial man, named as the ââ¬Å"Ex-Colored Man, who lived America in the late nineteenth century. He had to make a choice between two racial classes: blacks and whites.à He could embrace his black heritage and become the African-Ame rican musician or to live as an ordinary middle-class white man. The author depicts lynching as a vivid example of racial violence caused by white supremacy. The author shows how a black man was burnt alive by a white mob. He writes about the victim of the lynching scene, ââ¬Å"He squirmed, he writhed, strained in his chains, then gave out cries and groans that I shall always hearâ⬠(Johnson 83). The Ex-Colored Man, influenced by this event, makes a decision to pass as white man. James Weldon Johnsonââ¬â¢s representation of race relations is based on violence.In George Schuylerââ¬â¢s novel Black No More (1931), the race problem in America is discussed to place emphasis on the existing racial differences. The author of the novel uses satire to criticize racial relation. The author tells the story of a black man Max Disher who uses scientific transformation process to become a white man Mathew Fisher. In fact, the author criticizes the existing race relations through repre sentation of the skin color of his protagonist who becomes ââ¬Å"black no moreâ⬠(Schuyler 78). à In the novel Black No More, the author highlights the significance of the race problem in American society. He uses satire to depict the functioning of the myth of race purity caused by the existence of white supremacy.à Racism described by the author is used to serve economic purposes, which reflect greed as the major motivation of the main characters in their actions. The racist environment, in which the main characters live, depends on racial differences between the blacks and the whites.à Thus, the main character Max is rejected by a white woman Helen because she is a racist. However, Max makes a decision to remove his blackness to become closer to Helen. The change of black population to white leads to serious economic problems in American society because the cheapest black labor force is lost.In Octavia Butlerââ¬â¢s Kindred (1979), the reader is given an opportuni ty to assess a more complex representation of race relations in America. The author shows how African Americans address the history of ââ¬Å"racial Otheringâ⬠and the ways to struggle for their identity.à In the novel Kindred, the main character Dana, an African American woman, has a chance to be transported from the year 1976 to the early nineteenth century. She comes from Los Angeles to Maryland in order to meet her ancestors. She meets a white man Rufus and his slave Alice, a young African American woman. Alice was not a born-slave, as she was forced into slavery later in her life. Octavia Butler is focused on the use of time travel and the effects of genetic engineering to interrogate the historical paradigms of slavery in America. The novel Kindred is considered to be a neo-slave narrative that reflects historical reality of slavery in America. The author writes about race relations of white and black people living in the eighteenth century, ââ¬Å"they lived in ease a nd comfort supported by huge numbers of blacks whom they kept in poverty and held in contemptâ⬠(Butler 196).Thus, it is necessary to conclude that many novels in American literature are focused on representation of the struggle against slavery, but the authors use different approaches to highlight race relations and solve race-related problems. Three novels discussed in this paper, James Weldon Johnsonââ¬â¢s Autobiography of an Ex-Colored Man, George Schuylerââ¬â¢s Black No More and Octavia Butlerââ¬â¢s Kindred, are based on slave narratives that reflect the complicated relationships between slaves and their masters, and the relationships between the blacks and the whites, through shame, hatred and violence.
Monday, October 21, 2019
Marketing and Its Importance for Modern Organizations
Marketing and Its Importance for Modern Organizations Modern companies make substantial investments in marketing; in fact, this set of activities is usually essential for their sustainability. This is why it is necessary to define marketing and explain its importance for modern organizations. In my opinion, this term can be understood as every activity that is aimed at creating an extra value for the customers and ensuring that the companyââ¬â¢s products or services appeal to the buyers.Advertising We will write a custom essay sample on Marketing and Its Importance for Modern Organizations specifically for you for only $16.05 $11/page Learn More This is one of the possible explanations of this concept. But there are other definitions. For instance, Julian Gaspar says that marketing is ââ¬Å"the determination of the needs and desires of markets so that products and services can be developed, prices, promoted, and distributedâ⬠(2005, p. 276). This interpretation focuses on specific activities that are i nvolved in marketing. Other scholars emphasize the role customers and their needs. For example, Alan Fyall and Brian Garrod argue that marketing consists in determining the needs of target markets or finding ways of satisfying these needs (2005, p. 7). Thus, one can say that this term can be discussed from different perspectives. Overall, these definitions show that marketing plays a vital role in many organizations. First of all, it is important for understanding what clients actually want or what they expect from products or services of companies. This is why a great number of businesses conduct customer surveys in order to determine what kind of things buyers value most of all. For instance, software developers usually encourage users to test their products long before they are released. In this way, they can better usersââ¬â¢ needs and eliminate the defects of products. Thus, marketing is essential for increasing customersââ¬â¢ satisfaction. Additionally, marketing is impo rtant for increasing customersââ¬â¢ awareness about their products. Without it, companies can hardly hope for substantial revenues. This is why they develop strategies for spreading the information about their offerings. As a rule, they spend much time determining what kind of media is most suitable for them. For instance, they can choose television, radio, or internet. Their choice may depend on their product or the lifestyles of clients. These examples show that marketing strategies can be effective only if they take into account the behavior of clients.Advertising Looking for essay on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More Furthermore, marketing is important for retaining customers and differentiating the company among its competitors. This task is crucial for retaining strong positions in the market. Therefore, organizations develop different strategies for achieving this goal. For example, some of them attempt to win the clientsââ¬â¢ loyalty by setting lower prices for their products or offering some bonuses. However, many organizations pay more attention to the quality of their products or services. For instance, some producers increase the guarantee period while others attempt to customize their products and services. For instance, car manufacturers can design vehicles according to customersââ¬â¢ requirements. This is how they try to appeal to the clients. These activities are aimed gaining the loyalty of clients, and they are closely related to marketing. People, who develop marketing strategies, have to find ways of differentiating their products or services among others. On the whole, these examples demonstrate that marketing is closely related to many activities of a company such as product development, advertisement, after-sales services, pricing and so forth. Moreover, marketing should be based on the in-depth knowledge of customers, products, competitors, an d the industry, in general; otherwise it can hardly achieve its goals. Reference List Fyall, A. Garrod, B. (2005). Tourism Marketing: A Collaborative Approach. New York: Channel View Publications. Gaspar, J. (2005). Introduction to Business. New York: Cengage Learning.
Sunday, October 20, 2019
Essay on Deforestation
Essay on Deforestation Essay on Deforestation Throughout the tropics, rain forests are being cut down. By different methods and for different reasons, people in tropical regions of the world are cutting down, burning, or otherwise damaging the forests. The process in which a forest is cut down, burned or damaged is called "deforestation." Global alarm has arisen because of tropical rain forests destruction. Not only are we losing beautiful areas, but the loss also strikes deeper. Extinction of many species and changes in our global climate are effects of deforestation. If the world continues at the current rate of deforestation, the world's rainforests will be gone within 100 years-causing unknown effects to the global climate and the elimination of the majority of plant and animal species on the planet. Deforestation occurs in many ways. The majority of rain forest cut down is cleared for agricultural use-grazing of cattle, planting of crops. Poor farmers chop down a small area (typically a few acres) and burn the tree trunks, a process called "Slash and Burn" agriculture. Intensive, or modern, agriculture occurs on a much larger scale, sometimes deforesting several square miles at a time. Large cattle pastures often replace rain forest to grow beef for the world market. Commercial logging is another common form of deforestation, cutting trees for sale as timber or pulp. Logging can occur selectively-where only the economically valuable species are cut-or by clearcutting, where all trees are cut. Commercial logging uses heavy machinery, such as bulldozers, road graders, and log skidders, to remove cut trees and build roads. The heavy machinery is as damaging to a forest as the chainsaws are to the trees. There are other ways in which deforestation happens, such as the building of towns and flooding caused by construction of dams. These represent only a very small fraction of total deforestation. The actual rate of deforestation is difficult to determine and has been the focus of NASA-funded scientists for many years. NASA projects to study the deforestation of tropical forests are conducted by analyzing Satellite Imagery (pictures taken by satellites in space) to view areas of forest that have been cleared. Figure 1 shows part of a satellite scene, showing how scientists classify the landscape. There are both patches of deforestation and a "fishbone" of deforestation along roads. Forest fragments are isolated forest pieces left by deforestation, where the plants and animals are cut off from the larger forest area. Regrowth-also called secondary forest-is abandoned farmland or timber cuts that are growing back to become forest. The majority of the picture is undisturbed, or "primary," forest, with a network of rivers draining it. The most recent figures by the Food and Agriculture Organization (FAO) estimate tropical deforestation (rain forest and other tropical forests) at 53,000 square miles per year (15.4 x 106 ha/yr) during the 1980s (FAO 1993). Of this, they estimate that 21,000 square miles (6.2 x 106 ha/yr) were deforested annually in South America, most of this in the Amazon Basin. Based on these estimates, each year an area of tropical forest large enough to cover North Carolina is deforested. Each year! The rate of deforestation varies from region to region. Our research showed that in the Brazilian Amazon, the rate if deforestation was around 6200 square miles per year (1.8 x 106 ha/yr) from 1978-1986, but fell to 4800 sq. miles per year (1.4 x 106 ha/yr) from 1986-1993 (Skole and Tucker
Saturday, October 19, 2019
Globalization and health Inequalities Essay Example | Topics and Well Written Essays - 2750 words
Globalization and health Inequalities - Essay Example Lee (2000) explain that globalisation is an unavoidable and primarily gentle process of global economic integration, in which countries increasingly drop border restrictions on the flow of capital, goods and services. He further acknowledged that risks are a more rapid spread of disease through tourism and the speedier and more massive and regular movement of goods and people. He noted that the risks of globalisation processes can be managed and are more than offset by benefits in the dissemination of new ideas, technologies and steady global economic growth (Lee 2000). Whereas, Dowler (2007) define inequalities in health to mean difference in health experience between different groups of people, in that some groups of people experience poorer health than the majority of the population. This he said, is usually due to life circumstances, such as living in poverty, on low or fixed incomes, in poor housing, having few opportunities for social activities, a lack of connectedness to community; and, to discrimination arising from gender, poverty, ethnicity, age, sexual orientation or disability (Dowler, 2007). This paper will present a literature review on globalisation and its effects on health inequalities. The main objective is to provide a framework to understand how globalisation accelerates current changes in our lifestyles, the free movement of people travelling (Tourism) in relation to the rapid spread of infectious diseases, noticeably SARS. Inaddition, the estimate shows increasing gaps between the rich and poor that emerged in the various literatures. Research shows that the globalisation process as it is defined by Lee (2000) and others, that globalisation are responsible for the accelerated free movement of people. WHO (2003) estimated that more than two million travellers cross international borders on a daily basis. This includes not only economic migrants, refugees but also tourism. It is suggested that, a traveller infected with SARS could easily be transported across the globe six times within the incubation period of this deadly disease (WHO, 2003). This research will a nalyse this statement in detail and provide points for future research needs, based on the current globalisation policy debates and around the spread of diseases, and it will also make a case study of SARS in order to enrich the proposal. RESEARCH QUESTION: Does globalisation contribute to health inequality' AIM: To analyze and discuss, where, why and how the globalisation process affects or accelerates health inequality OBJECTIVES: 1. To see what has and has not been investigated about globalisation and how does it affect health inequality 2. To identify potential relationships between the concepts and to identify researchable needs in the area 3. To develop an understanding of how free movement of people such as tourism has changed cultures/lifestyles, through the process of globalisation 4. To demonstrate knowledge of the history of the spread of infectious diseases and globalisation of trade and investments 5. To discover how my research project can be related to the work of others LITERATURE REVIEW I will conduct my research, from the
Friday, October 18, 2019
Operation Paper Essay Example | Topics and Well Written Essays - 500 words
Operation Paper - Essay Example The business operations need to be overseen by the leaders of a particular organization which ensures that the set targets are achieved and even surpassed. The operations of the businesses undertaken by the organization need to be well organized as well. Organizations of all forms have a group of leaders who oversee the running of its daily business. The codes of conduct followed by the leaders of the organization are stipulated in the constitution of the memorandum of understanding of a particular organization. The leadership of the organization has to have leaders who are well versed with the operations of the business (Ryans, More, Deutscher 49). If the organization is a form of innovation, its operations have to be run by an entrepreneur who came up with a business idea being implemented in a particular organization. Alternatively, if the entrepreneur or the owner of the business is just an initiator of the idea, entrepreneurs can come up with newer innovations to improve the entrepreneursââ¬â¢ ideas. For an organization to reach its profit targets, it should treat all its stakeholders well. This is because, the stakeholders, most especially the consumers, creditors and employees play a key role in production and supply. If an employee, creditor and consumer are satisfied, profitability will be achieved. The leaders selected to manage the operations of the organization must possess the qualities of good leaders. Organizational leadership is the key to a successful organization since it is a major ingredient to quality output (Ryans, More, Deutscher 70). A business being an organization whose main objective is generating profits needs to be marketed. Business marketing is the act of marketing an organizationââ¬â¢s products to another business that further sells it to the consumers. This activity of business marketing is mostly delegated to the marketing department, which is given the role of
Clinical Leadership Assignment Example | Topics and Well Written Essays - 4500 words
Clinical Leadership - Assignment Example In my role as a team leader in the corporate health board I came across many learning situations and instances that greatly helped me in identifying my strengths in dealing with people and situations, and realizing my personal weaknesses that made me hesitant to make a proactive approach at work. During my tenure in the corporate health board as a team leader, I had exposure to managerial concepts and leadership qualities that are required to perform a task more effectively. As a team leader, I have to be in touch with all aspects of the teamwork in addition to coordinating with my supervisors, allocating responsibilities to my team members, motivating the team, monitoring their work and resolving issues. Each of these activities is different from the other and requires different levels of consideration and attention. My role as team leader provided me with plenty of opportunities to manage team issues, plan and coordinate activities with the rest of the team members and develop lead ership qualities. The application of clinical leadership in the practical environment has numerous benefits and the need for developing leadership qualities among clinicians is increasingly being felt in the current scenario. The adoption and effective development of leadership skills in clinical health care environment contributes to efficient patient care and improving staff motivation. Clinical supervision or leadership provides a ââ¬Å"framework for self-regulation and developing informed deliberative practice, emphasizing not only self-monitoring through reflection on action but also the reflection in actionâ⬠.
Essay Example | Topics and Well Written Essays - 750 words - 120
Essay Example He also helps the composers connect their creative and innovative ideas with the need of the audience for musical freshness and beauty. The various types of classical music are played free of charge with the major goal of building talents. The article made me reflect on and think about a number of things as far as talent development is concerned. Firstly, it gave me a picture of the university as a place that is not only meant for academic excellence but also a place to nurture talents in other fields. This is contrary to the misconception held by many that the university involves serious study with no play. It is quite interesting that the Music Today Festival is organized and coordinated by one of the universityââ¬â¢s senior professors, Kyr Robert. It also made me reflect on the importance of music, especially for professional means. Considering that the professor heads the music department in the university, it seems that there are institutions that value music not only as a way of entertainment but also as a profession. I also came to understand that there are students studying music as a course, just for professional purpose. This made me remember one question that is very common, especially among journalists, when interviewing musicians; ââ¬Å"apart from music, what else do you do?â⬠many people have taken music not as a career but as a way of entertainment. The article is a good source to teach the society on the importance of music not only as a means of entertainment but also as a profession. In other words, the article mainly triggers thoughts about the importance of music in the society as well as the role of music as a way of relaxation to enable students study better. One thing that surprised me is that the festival is not only unique in the University of Oregon alone. Several other institutions place a high value on music and use it as a way of nurturing talents and enhancing
Thursday, October 17, 2019
None Essay Example | Topics and Well Written Essays - 750 words - 3
None - Essay Example The family is met with a severe accident but all of them are saved to be killed at the hands of the serial killer, Misfit. This story is one of those in which complex and comprehensive themes are presented in clear and plain language. This is a simple story like a picture which is able to speak a thousand words. The major themes in this story include faith, morality and self conscience along with other religious connotations. Another major theme revolves around trust, mistrust and faith which the author has portrayed specifically during the first stop of the family at The Tower with their owners. The owner, Red Sammy Butts and his wife get engaged in a conversation with the family. During this conversation, the owner and the grandmother talk about the reality of the world and the moral ethics and codes which were ignored by people in everyday life. They talk about how no one in the world could be trusted anymore. Red Sammy Butts shares his experiences of mistrust about how he helped some people and gave them something on credit and never saw them again. This conversation leads to the ugly truth of the world, the presence of good and evil and the ultimate reality that no one can be trusted. The title of the story itself portrays the theme of the story that good men are hard to find this world, those who live, not for themselves, but for others. The author has tried to describe the shortcomings of the traditional meaning of good and bad. This traditional concept states that people can either be good or bad but in this story, O`Connor has tried to depict that both good and bad can exist within a single person. The author enforces that a person can find both good and bad but it just depends on the way he searches for it. Similarly, the initial story is portrayed in such a way that the reader would think that the story shows a good family and a bad convict, misfit. However, this is a false impression which is corrected at the end of the story. After the accident, th e grandmother and the whole family meets misfit and his gang. The grandmother`s judgmental nature results in a serious conflict between her and misfit which results in the death of the entire family. The grandmother thought that the only thing that will save her from the killer was her supposed good deeds and good nature. However, the story initially shows that the grandmother is a self serving person and she is clearly a racist and this is shown by her comment about the street children as she says, ââ¬Å"Little niggers in the country don't have things like we doâ⬠(A Good Man is hard to find, Web). This clearly shows that the grandmother was a racist and during her encounter with Misfit, she thought she was good and her goodness will save her from the convict. She even called Misfit and ââ¬Å"alleged criminalâ⬠and tried to enforce her superior position which further worsened the conflict between them. However, Misfit had more power than the grandmother at that time and he decided to end her life. Faith is a person`s belief in something whether it be God, a religion or even a personal trait, for example. The Misfit did not have any such belief in any religion but he seems to have faith on himself. The grandmother even tries to bring in religion and Jesus to change Misfit`s mind. She tries to save herself by bringing in Jesusââ¬â¢
Democratization efforts in the Gulf Essay Example | Topics and Well Written Essays - 250 words
Democratization efforts in the Gulf - Essay Example However, more still needs to be done to ensure that the democratization process is effective. There is a need to establish reforms in the judiciary and allowing the civil society to perform their oversight duties. The limits of educational policy as an engine of social change and economic uplifting can be discussed from a number of perspectives. The Middle East education is inherently based on the religious teachings of Islam2. Anything contrary to this form of education is disregarded. The Middle East does not have educational policies that bring about social change in the region. Education is centred on religion, and this, hinders other tenets of education to be wished away as they are regarded as tools that undermine the Islamic faith3. It is important to note that certain elements of the education system in the Middle East are relevant to the needs of the people only to some
Wednesday, October 16, 2019
Essay Example | Topics and Well Written Essays - 750 words - 120
Essay Example He also helps the composers connect their creative and innovative ideas with the need of the audience for musical freshness and beauty. The various types of classical music are played free of charge with the major goal of building talents. The article made me reflect on and think about a number of things as far as talent development is concerned. Firstly, it gave me a picture of the university as a place that is not only meant for academic excellence but also a place to nurture talents in other fields. This is contrary to the misconception held by many that the university involves serious study with no play. It is quite interesting that the Music Today Festival is organized and coordinated by one of the universityââ¬â¢s senior professors, Kyr Robert. It also made me reflect on the importance of music, especially for professional means. Considering that the professor heads the music department in the university, it seems that there are institutions that value music not only as a way of entertainment but also as a profession. I also came to understand that there are students studying music as a course, just for professional purpose. This made me remember one question that is very common, especially among journalists, when interviewing musicians; ââ¬Å"apart from music, what else do you do?â⬠many people have taken music not as a career but as a way of entertainment. The article is a good source to teach the society on the importance of music not only as a means of entertainment but also as a profession. In other words, the article mainly triggers thoughts about the importance of music in the society as well as the role of music as a way of relaxation to enable students study better. One thing that surprised me is that the festival is not only unique in the University of Oregon alone. Several other institutions place a high value on music and use it as a way of nurturing talents and enhancing
Tuesday, October 15, 2019
Democratization efforts in the Gulf Essay Example | Topics and Well Written Essays - 250 words
Democratization efforts in the Gulf - Essay Example However, more still needs to be done to ensure that the democratization process is effective. There is a need to establish reforms in the judiciary and allowing the civil society to perform their oversight duties. The limits of educational policy as an engine of social change and economic uplifting can be discussed from a number of perspectives. The Middle East education is inherently based on the religious teachings of Islam2. Anything contrary to this form of education is disregarded. The Middle East does not have educational policies that bring about social change in the region. Education is centred on religion, and this, hinders other tenets of education to be wished away as they are regarded as tools that undermine the Islamic faith3. It is important to note that certain elements of the education system in the Middle East are relevant to the needs of the people only to some
Accounting standards and principles Essay Example for Free
Accounting standards and principles Essay In 1973, international accounting standards committee issued international accounting standards (IAS) which lasted till 2000 when they were replaced by IFRS. These are standard based principles, accounting practices guidelines, interpretations and framework adopted by the (IASB) (Epstein Jermakowicz, 2010). In 2001, IASC was replaces by IASB which was mandated in setting international accounting standards. The objective of IFRS is to make companies financial statements to reflect truth and fair view of companiesââ¬â¢ affairs as at particular date (Epstein Jermakowicz, 2010). Generally accepted accounting standards are principles and accounting guidelines recognized by a given territory, jurisdiction or most countries especially the United States to supplement the role and objectives of IFRS. Financial statements should be presented, summarized and recorded based on particular generally convections, rules, ethics and standards in a certain jurisdiction i. e. GAAP. Formulation of GAAP and IFRS For consistency and fairness in financial statements which detail the performance of a company, certain rules and standards must apply. See more: Satirical elements in the adventure of Huckleberry Finn essay These are commonly referred to as ââ¬Å"generally acceptedâ⬠and all accounting professionals apply them as appropriate and ethical. Failure to apply them in accounting field result to agreed penalty by either body governing the practice or the territory restraining unethical practices to professionals. Various committees and bodies are put in places as setters which formulate and develop these accounting standards. International Financial reporting standards are developed and formulated by International Accounting Standards Board while Generally Accepted Accounting Principles are formulated by local financial reporting standards board. In the United States, the establishment and development are influenced by the United States Securities and Exchange Commission (SEC), American Institute of Certified Public Accountants (AICPA), Financial Accounting Standards Board (FASB), and Government Accounting Standards Board (GASB) (Miller Bahnson, 2002). All these bodies and committees have different roles and objectives which are agreed upon on influence to different accounting sectors profession generally accepted principles. International financial reporting standards are based in International Accounting Standards which are accepted globally. ISA changed its operations in 2000 and IFRS were added to cope with the changing dynamics of global accounting profession. Through discussions, contributions and comparison agreements, different bodies through their representatives contribute to the principles developed by IASB. Complete responsibility in all technical matters that include; preparation and issuing of international financial reporting standards, are based on the selected IASB (ISCF IASB, 2007). Thus, the efforts of IASB involves, setting standards, formulating process of adopting standards ensuring the needs of different countries in the globalizing accounting profession (Mwaura Nyaboga, n. d). Difference between GAAP and IFRS GAAP and IFRS have difference in their jurisdiction of usage, enforcement and the way these standards are formulated. International financial reporting standards are globally recognized accounting standards, which are set by IASC from 1973 to 2001 and from 2001 by IASB. GAAP are accounting standards recognized as ââ¬Å"generally acceptedâ⬠by the United States. In summarizing, recording and presenting accounting information within a nation, the process is dictated by rules and convection of GAAP in the United States. International accounting standard board does not directly set or control provisions of rules and convections adopted by GAAP. Standards set by this powerful board are based from agreements and suggestions from various local accounting boards e. g. Kenya accounting board (KAS). Various nations will try to incorporate the set standards within the GAAP in their country. FASB in America has a mandate to set accounting rules, convection and standards that are later adopted by the US GAAP (Mwaura Nyaboga, n. d). This means that the role of formulating and developing the rules and standards principally lie to the local accounting boards. Various nations have made it compulsory for their accounting practice to adopt IFRS rather than developing jurisdiction GAAP (Mwaura Nyaboga, n. d). In addition, differences on the implementation and formulation exist in financial presentation between GAAP and IFRS. These differences are commonly in consolidation, statement of income format, inventory valuation and recognition, earning per share calculations and development cost recognition in financial statement. For example, in United States, consolidated financial statements are prepared on risk and reward models while international financial reporting standards prefers control based model where consolidation is done on the percentage of control and influence in subsidiaries and associates (Forgeas, 2008). Risks and rewards is more complicated since risk are subjective valued. Extraordinary items such as depreciation and amortization are included in the income statements under IFRS and in the US GAAP are accounted for after net income. This means extraordinary expenses are not taken to contribute net profits (Forgeas, 2008). Under the US GAAP, companies have option to use either LIFO OR FIFO methods of inventory valuation while in IFRS, LIFO method which is historical valuation method is recommended. When computing for earning per share under IFRS average on interims calculations are not included whereas in the US GAAP, computation requires that individual interim increase in shares be done averagely (Forgeas, 2008). Capitalization on development expenditure is done under IFRS and recognized as fixed asset while in the US GAAP; capitalization is not done on development expenditure but is accounted for in income statement as expenses (Forgeas, 2008). Another difference between GAAP and IFRS is how transactions are interpreted to mean. It is commonly argued that GAAP within a nation is rule based and IFRS is principle based. This means that transactions are interpreted based on the stated rules and standards. Ruled based interpretations lies with the professional judgment on certain transaction treatments in account. For principle based interpretation, the IFRS provide on more judgmental way to interpret transactions. This implies that principles are there to the interpretation of transaction and in rule based is on the professional judgment. The problems arise on whether judgment is accurate professional judgment or guessed professional judgment to transactions treatment (Forgeas, 2008). Benefits of GAAP and IFRS Uses of standardized procedures to financial statements summarizing, recording and presentation to the users bears a number of benefits to both the reporting entity and the user such as shareholder, lenders, creditors or the government taxation organ. Adoption of GAAP in the US and IFRS by other countries gives significant economic and financial benefits to decision making. Both approaches give consistency in managing companies and it is easy to compare companies using the same standards. Both standards put strict measures on deviation from the rules and ethics in a particular standard. In most countries for a company to trade public GAAP and IFRS must be followed and they require all financial statements be subjected to an independent audit and opinion thereby be given on the applicability of standards in the company. These independent accountants (auditors) must certify financial statements and any notes to financial statement have been prepared and to be presented in accordance of either of the standard. These two provide adequate explanations and definitions to transactions, provide needed assumptions to these transaction and methods applied in either computations or accounting for the transaction. By this, companies are able to follow the requirements year by year enhancing comparisons/benchmarks between companies and consistency in business operations. Valuation of various assets and liabilities both at the start and at the end of the year would be different between companies giving hectic time in comparison and auditing. These two standards enhance transparence and uniformity of valuation procedures of assets. For example, valuation of assets like investment and stocks unrealized profits can be ambiguous if such standards are not in place. Conclusion To make financial statement present a true and fairly performance and position of the business at a particular date, financial accounting standards are needed. High quality standards need to be set for reliable information that is adequate and useful to investor or creditor. These high quality standards and enforcement will provide transparency in business operations and promote full discloser to financial information which gives consistent application making statement user perform comparison of year by year and among competing companies.
Monday, October 14, 2019
Britannia International Hotel Industry: Analysis
Britannia International Hotel Industry: Analysis This is the strategic report on the Britannia International Hotel industry. It discusses the scheme of the strategic management in the business with the analysing of the tools of the strategy in the day to day operations of the business. Strategic report is focusing on the impact analysis of the business strategy of the hotel industry with the giving of the overall view on the strategic management scheme in the hotel industry. It is ideally giving of the recommendation for the improvement of the performance level of the hotel industry in the current market with the adoption of the suitable , feasible and acceptable techniques of the Hospitality Management to improve the level of the performance in the business. Introduction This is the strategic assignment focusing on the Britannia International Hotel Industry in London. The aim of the assignment is to discuss the strategic policy management of the Britannia International Hotel industry in London in the relation to their internal and external business environment. The Britannia International is one of the prominent hotel industry in the London situated at the heart of the city at Canary Wharf, London. They are having 35 hotels across United Kingdom using 7000 bedrooms, One of the hotel at the prime location of the city in London at the Canary Wharf is the key success factor nearer to the major airports and the seaside resorts surrounded by stunning country side (Lehman,2007) The strategic aim of the hotel industry is to provide the optimum money value at the desired level of the satisfaction facilitating to the easy opportunity of the decision-making to the guests who are coming ion the hotel industry (Buidcon,2009) As the London is an international cit y in the world many guests are used to come here from the different parts of the world in order to enjoy the city of London with its greenery, atmosphere, surroundings ââ¬â due to which there is a wide scope of the development of the Hospitality industry in this area in order to hospitalise the visitors in this country. As a result many hotel industries are the wide popular in this city used to earn the good source of the potential income and sales turnover. The Britannia International at the Canary Wharf is offering the extremely competitive rates in the combination with the flourishes decoration with the facilities including restaurant, health club, night club, bars and free wireless internet access. (Gary,2010) The hotel is situated on the waters edge next to the Canary Wharf, at the Docklands of the London in the internationally developed renowned office development, the hotel industry is fully modernised in the traditional culture having up to date facilities (Simson,2009) Modern style hotel located on the waterside in Londons docklands closed to Canary Wharf where there are many international businesses as well as large shopping centre , various restaurants and Bars (Gilston,2010) Literature Review Business Strategy of the Britannia hotel industry is purely of the functional and authoritative nature, Hotel industry is rationally divided in to four parts of the line of the organisational set up in which there are the functional departments are diversified as per the core area of the business management, Strategic planning of the hotel industry is made on the basis of the grouping of functions in to four imperative divisions they are the Operations, Human Resource, Marketing and Finance, Information Management section is the co-coordinator of all the departments which is involved in the transfer of the information with in the different active departments as a core functional chain in the business (Tandon,2007) Strategic Management of the hotel industry is having a dynamic and imperative weight in the international cities as per the depending of the nature and scope of activities , many guests and visitors are used to come in the city of London which has created an enormous beauty and scope of the activities of the hospitalisation in the city of London, different services are provided as per the capability and intensity of the hotel industry at the reasonable rates in order to achieve an optimum level of the satisfaction from the customers, supplier power of the hotel industry is really is magnificent they are providing the restaurant, Bar, Kitchen, living and boarding facilities having 4 big halls for the conducting of events such as marriages, birth day parties, functions, meetings, ceremonies in which the area of the potentials of the hotel industry are based, recently they are planning to start the travel and tourism operations as their supportive area of activity to the core functional scheme which is the additional source of the revenue recognition (Rodrics,2010) Glance situation of the hotel industry at the magnified location is the measured strength of the hotel industry at the Canary Wharf , the increasing the number of the people with the large sco pe for the sale of the food items in the glorious location of the hotel industry are some of the ideal characteristics of the hotel industry giving the prominent scope of the development and hospitalisation (Small,2009) Intensity of the buyer towards the hotel industry is strategic and sound as they are willing to get the supreme level of the services with in the reasonable costs and achieving the enjoyment of the city of London, Docklands area near to sea shore is giving the glance opportunity of the business development to the Britannia international hotel industry at the higher rate of income with the global status and the exclusive customer support, they are having a stratified customer relationship management strategy in which functional scope of the CRM dimensions has been predicted through the norms of the customer identification , customer attraction, customer development and the customer retention (Philip,2008) The strategic Management of the Hospitality industry in London is the core activity of the management in which functional scope is administered as a tool of the resource management, Operational activities are coming under the day to day performances of the business and regular services to the guests who are coming in the hospitality industry in order to acquire services and potentialities for the earning of the higher revenue generation in the day to day operational management, Human resource strategy is the core activity of the functional management in which major concentration is given on the process of the recruitment and selection of the new candidates in the service so as to get completion of the business activities in the right strategic order and at the right time with in the reasonable resources, Marketing Activities are the activities which are relating to the development of the market through the making of the strategic relationships with the customers and attracting them in the shoes of the customer in order to develop and expand the business activities, Finance department is involved in the strategic financial operations including the accounting , internal audits, finance management, investments in the area of the business so as to maintain the liquidity and the cash management in the day to day business operations, Information Management department is the channelising information department in the business with the providing of the time to time information in the order to regulate the departmental activities in the business organisation (Shardul,2010) Discussion The strategic report is discussing on the management policy of the Britannia International Hotel industry. In the international city of London the wide scope is available for the hospitalisation sector as many visitors are used to come here from the different parts of the world in order to pursue their education, jobs, picnics and visits, living. In due course of the same there is a wide scope available for the development of the hospitality industry in this city to entertain the visitors . There is a wide scope of the strategic management in the hotel industry so as to administer the group of activities in the business management policy of the hospitalisation. Business strategy has been constructed as per the model guideline of the core hospitalisation. Hotel industry is using the effective and efficient Customer Relationship Management strategy in order to make the long lasting relations with the guests, visitors in the shoes of their customers . The strategy of the Customer Relati onship Management has been constructed in the view of the implementation of the efficient and effective CRM dimensions of the customer identification, attraction, retention and development to make the expansion of the business activities to capture the wider segment of the market. Market development strategies used to be formed with the using of the effective marketing communication techniques such as advertising and publicity , sales promotions, direct marketing , public relations and personal selling which will be helpful to develop the good communication system of the hotel with the creating of the Goodwill in the business. Business strategy of the Britannia international is constructed as per the ideal divisions of the functional activities in the four major departments specifying the executive strategy of the hospitality operations. Critical Analysis Strategic Management policy of the Britannia hotel industry is a constructive idea of the operational profile in which there is a wide scope available for the coverage of the functional area of activities. The strategic idea of the functional approach of the management policy is depending on the availability of the strategic factors which are in the support of the management and get inverse with the management. Following are the SWOT analysis are focusing on the internal and external factors of the hotel industry ââ¬â a) Strengths Glance location of the hotel industry in the midlands nearer of the dockland airport is facilitating the visitors to take stay in the hotel. Availability of the feasible facilities including the air conditioned rooms, lodging and boarding, Restaurants, Bar,Kithen are all giving the strengths of the business. Staff operations are commensurate to the strategic development of activities , with the expertises of the staff and availability of the potential capacity of the labour services. Availability of the tourism operations is creating an additional constructive strength of the business . The scope of the information management department is to handle the ideal activities of the marketing function through the implementation of the different strategic marketing techniques. Availability of full fledged well furnished rooms , with the big halls for the events, ideal structure of the hotel set up is an added advantage. b) Weaknesses ââ¬â No scope for the parking facility of the vehicles in the surrounding area of the hotel industry. Increasing the rate of the labour turnover in the business with the improper workforce management activities. There is a serious increases in the budgeted expenditures of the hotel industry in due course of the increasing the labour turnover of the business. Reduction in the profitability of the business over the period of time is affecting on the performance level of the hotel industry. Increasing in the costs expenditures will commensurate to the revenue recognition from the day to day operational control of the business. c) Opportunities ââ¬â There is a greater scope available for the hospitalisation in the area of Canary Wharf. As London is one of the international city in the world many visitors are used to come here for the visits , picnic, education,travel,living,jobs. So that there is a wide scope of the opportunities for the development of the business is available towards the international visitors. Performance level of the hospitality industry is at the optimum rank , further there is a wide scope of the development to increase the level of the performance of the business with the employment of the skilled, efficient labour in the day to day business operations. Level of the business management can be used as a basis of the chanelising the information management function in order to acquire the objectives of the business. d) Threats ââ¬â As the London is an international city in the world, many spectators are used to come here from the different parts of the world. It is therefore there is a wide scope for the development of the Hospitality industry in this area. The scope of the Hospitalisation is quite more in this city of London. Due to which many hotel industries are used to operate in this city to entertain the globalise visitors, guests. It is leading to the emergence of the different hotel industries. Hotel Hilton Metropolitan, Hotel Syon Park, Hotel Chariot Mirror are some of the leading hotel industries in the city competing the Britannia International. SWOT analysis is pertaining to the focus on the internal and external business environment which shows an exact picture of the hotel industry in a strategic manner. In depth focus further can be made in the business activities through the applications of the tool of the Porters five forces ââ¬â Supplier Power ââ¬â It is the creative idea of the different facilities offered by the Britannia hotel industry in the hospitalisation. They are having Bar , Restaurant, Kitchen services , lodging and boarding facilities , full well furnished air conditioned rooms which are attracting the visitors in the hotel. At one time more than 100 of people can have stay in the hotel in the well furnished rooms. There is an optimum level of the food facility available for the guests and visitors. Bar services are more timely and co-efficient. Operational strategic management has been done based on the implementing the ideal strategy of the hospitality management and its core area of the knowledge. The Hotel industry is having the strategic supply power which can attract the large number of customers in order to increase the capacity sales. Buyer Power ââ¬â This is the power of the buyer intensity in which study of the buyer behaviour has been conducted. Buyer power is created with the availability of the financial position of the buyer leading to increase in the level of consumption. Understanding of the buyer behaviour in the business is a strategic task of the assessing of the demand position in the current market. On the basis of which the supplier power can be built up in the day to day business operations. In every business intensity of the buyer capacity is playing a strategic role. As the Uk is in the recovery stage of the credit crunch situation in the market, it is leading to the increase in the level of the economy along with the employment opportunities in the business. With the help of that the earning potential capacity of the buyer is now upgrading leading to the increase in the level of consumption. Market Competition ââ¬â There is a strategic competition in the market. As the London is an international city there is a major scope for the development of the Hospitality sector because people who are coming from the different parts of the world are need to have facility for their hospitalisation and care. In due course of which many hotel industries are used to operate in this city creating a challenging business environment for the hospitality industry. With the availability of the international Hotels such as Hilton Metropolitan, Syon Park, Mirror Chariot there is an ultimate reduction is felt in the business of the Britannia international. Threat of New Entrants ââ¬â There is a serious threat of the new entrants who are coming in the market. As this city has a wider scope of the hospitalisation business in due course of the international visitors, the scope of the hotel industries has been increased in this area. For the entertaining of the guests, visitors there is a need of the new resraurants,hotels which ultimately had given rise to the commencing of the new hotel industry businesses , which can create a challenging threats for the Britannia International as the same quality food may be available at the more cheaper rates in the new hotels for the sake of the capturing of the market. Barriers to New Entrants There are the certain barriers are available in this country for the new hotel industries. Govt. Licensing is a challenging task which requires the many compliances of the documents and still no assurance of the sanctioning of the license. Another problem is of the capital funding as London is one of the costly city in the world , there are the many requisites are raised for the mobilisation of the capital and still there are the issues which are arising in the starting of the business. These are the serious challenging barriers to the new entrants. Findings It has been found on the basis of the strategic analysis that there are the different strategies and customs are applied in the business. The normative strategic planning of the business is based on the Porters generic scheme. a) Cost Leadership ââ¬â There is a cost efficiency and effectiveness is maintained in the business which is leading to the maximisation of the profits. Quarterly budgets are prepared indicating the schedule of the expenditures and the actual performance is used to compare with that schedule in order to improve the strategic performance of the business. Executive cost control is maintained in the business as a strategic tool of the business. b) Focused ââ¬â The ideal focus of the activities is based on the restaurant and lodging and boarding activities. In the restaurant the strategic activities which are focused are the kitchen services, Bar services, Operating services. In the lodging and boarding activities the ideal services are the well furnished rooms along with all the facilities of the toilets, bathrooms. c) Differentiation ââ¬â With the continuing of the focused core area of activity of the business hotel industry is planning to develop the new activity of the Travelling and Tourism operations which will facilitate the additional source of income of the business as the supportive level of activity to grow the business in the Hospitality sector. Conclusion and Recommendation The Britannia international is one of the reputed hotel industry in London having its strategic significance all over the world. Wide scope of the business with the glance opportunity is available for the expansion and development for the hotel industries. The Britannia hotel is having the imperative strength of the good supplier power , ideal resource management scheme which will be commensurate for the strategic management policy of the business. Good location of the hotel industry , facilities available are of the restaurant, bar , kitchen services , lodging and boarding services which are giving the scope for the business expansion and development. However, as the London is an international city in the world many spectators are used to come here for the travels, visits, education there is a wide scope of the development of the hospitality sector in order to catch the wide area of the business development. This is giving scope for the development of the many hospitality industries creating the market competition . Hotel Hilton, Hotel Syon Park, Hotel Passage to India are the hotels creating a challenging environment for the business. It is recommended to the hotel industry to give scope on the marketing communication techniques of the sales promotions and direct marketing in order to grow and expand the business. In the sales promotions focus can be on the giving of the different attractive discounting offers which can catch the customers. In the direct marketing hotel industry can use the strategic technique of the e-mail communications system to contact directly with the customers.
Subscribe to:
Posts (Atom)